Gene detail

Detail information of GWHGAAZE000956

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO96805.1	5.56597E-52	unnamed protein product [Coffea canephora]
Swissprot	tr\|P54609\|CD48A_ARATH	4E-53	Cell division control protein 48 homolog A
trEMBL	tr\|A0A068TKJ7\|A0A068TKJ7_COFCA	2E-52	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO96805.1}
TAIR10	AT3G09840.1	4E-46	cell division cycle 48

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	20435622	20435975	+
GWHAAZE00000001	mRNA	20435622	20435975	+
GWHAAZE00000001	exon	20435622	20435975	+
GWHAAZE00000001	CDS	20435622	20435975	+

Transcript Sequence
>GWHTAAZE000958 ATGCCCCCTCAAATCATTTTTATTGACGAGATCGATTCAATTGCTCCCAAGAGAGAGAAGACAAATGGTGAAGTTGAAAGTAGGATTGTTTCACAACTTTTGACTCTAATGGACGGACTGAAATCTCGGGTCCATGTTCTTGTGTTGGGGGCCACAAATCGTCCAAACAGCATTGACCCGGCTTTGAGAAGGTTTGGTAGGTTTGACCGGGAAATAGATACAGGTGTTCCTGATGAAGTTGGACGTCTTGCAGTTCTACGTATTCATACCAAAAAGATGAAGCTCTCTGAAGATCTAAGGCCTAAAAATAATAAGAAAATGGATGAAAAACTTCTTCGTTGTTGTATCGAGTGA

Network for GWHGAAZE000956

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00004.30	AAA	3	74	5.60E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13525	VCP, CDC48	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.875
	SRR3591706	second leaf	4.056
	SRR3591707	mature leaf	1.764
	SRR3591708	Shoot apex	7.711
	SRR3591709	Stem	5.123
	SRR3591710	White floral bud	5.359
	SRR3591711	White flower	5.916
	SRR3591712	Green floral bud	6.673
	SRR3591713	Yellow flower	4.273
SRP173429	SRR8316895	Juvenile bud stage	5.353
	SRR8316896	Juvenile bud stage	4.712
	SRR8316897	Juvenile bud stage	3.235
	SRR8316894	Third green stage	1.144
	SRR8316900	Third green stage	4.747
	SRR8316901	Third green stage	4.244
	SRR8316898	Complete white stage	1.619
	SRR8316899	Complete white stage	4.379
	SRR8316903	Complete white stage	3.938
	SRR8316902	Silver flowering stage	0.649
	SRR8316904	Silver flowering stage	1.410
	SRR8316905	Silver flowering stage	1.034
	SRR8316906	Gold flowering stage	3.247
	SRR8316907	Gold flowering stage	2.100
	SRR8316908	Gold flowering stage	2.554
SRP132670	SRR6706286	Control	3.493
	SRR6706287	Light intensity 50%	5.060
	SRR6706288	Light intensity 20%	5.324
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.855
	CNS0095593	Slightly white alabastrum(diploid) 2	2.111
	CNS0095594	Slightly white alabastrum(diploid) 3	3.179
	CNS0095595	Whole white alabastrum(diploid) 2	2.036
	CNS0095596	Whole white alabastrum(diploid) 3	1.631
	CNS0095597	Whole white alabastrum(diploid) 4	2.650
	CNS0095598	Silvery flower (diploied) 1	3.030
	CNS0095599	Silvery flower (diploied) 2	4.138
	CNS0095600	Silvery flower (diploied) 3	3.996
	CNS0095601	Golden flower (diploid) 1	1.623
	CNS0095602	Golden flower (diploid) 2	3.232
	CNS0095603	Golden flower (diploid) 3	3.362
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.028
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	5.848
	CRR073298	Stem 2	3.117
	CRR073299	Stem 3	0.334
	CRR073300	Leaf 1	5.801
	CRR073301	Leaf 2	4.500
	CRR073302	Leaf 3	0.386
	CRR073303	Juvenile bud 1	1.354
	CRR073304	Juvenile bud 2	0.132
	CRR073305	Juvenile bud 3	0.413
	CRR073306	Third green 1	0.239
	CRR073307	Third green 2	0.379
	CRR073308	Third green 3	0.371
	CRR073309	Second white 1	0.140
	CRR073310	Second white 2	0.086
	CRR073311	Second white 3	1.383
	CRR073312	Silver flowering 1	0.134
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.413
	CRR073317	Gold flowering 3	0.118
	CRR073318	Tawny withering 1	2.044
	CRR073319	Tawny withering 2	1.535
	CRR073320	Tawny withering 3	1.018