Gene detail

Detail information of GWHGAAZE000886

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07132.1	9.4599E-99	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8GY42\|NAC25_ARATH	7E-72	NAC transcription factor 25
trEMBL	tr\|A0A068UFT8\|A0A068UFT8_COFCA	4E-99	Coffea canephora DH200=94 genomic scaffold, scaffold_24 {ECO:0000313\|EMBL:CDP07132.1}
TAIR10	AT1G61110.1	6E-60	NAC domain containing protein 25

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	18842050	18843795	-
GWHAAZE00000001	mRNA	18842050	18843795	-
GWHAAZE00000001	exon	18842050	18842433	-
GWHAAZE00000001	exon	18842975	18843261	-
GWHAAZE00000001	exon	18843624	18843795	-
GWHAAZE00000001	CDS	18843624	18843795	-
GWHAAZE00000001	CDS	18842975	18843261	-
GWHAAZE00000001	CDS	18842050	18842433	-

Transcript Sequence
>GWHTAAZE000888 ATGAAAACAGAATTCATTTCAGGTTTCCATTTACCTCCCGGATTCCGATTCCATCCCTCTGACGAAGAACTTATTGAACATTACTTGCTCAACCAGCTCAACTCGCGTCCACTCCCAGCAAATTTAATCGCGGAAATAGAACTCTATAACTACAATCCATGGGAATTGCCAAAGAAGGCCTTGTTTGGAGAAAATGAGTGGTATTTCTTTAGTCCAAGGGATCGGAAGTACCCAAATGGCGCGAGGCCAAATAGGGCGACGAGTATGGGTTTTTGGAAGGCTACTGTAACCGATAAGCCTATACTTACTTCTTCTGGTTCGAGAAGAATAGGGGTGAAGAAAGCCCTGGTGTTTTACATGGGTAGCCCTTCTAACGGCGTTAAAACAGATTGGATCATGAATGAGTATCGATTGCCCGATATGATGATCCGTCCCGCGAGGTTGAAAGGGTCCATGAGATTGGATGATTGGGTACTATGCCGTGTCAGACAAAAAGGCAACATGTCAAAGAACAGACTAGAAGAAGCACAAGGCAGTCCTACGAAGTGCATGCCAACTAAGAAAGTTGAGGATCATCAAATCCCTTCACAATACAAAAATAGTTATGCCAACATATCATTCACCAAAGATTATCTATTTAAAGACTGCCATCTGCTAGCTTCCATGTTAAATGGCCAAAATCTTCCTGCTATGGAGCCCATTTCTTCCACATCCATTCCATTTAGAAGTATCAAAGATGAAAATTTCTTTAATCAAAATCAGTCCCAAGGAGAAATCTTCGAGTTTGATAACCCGAATGACATGATAAATTTATGCAATTTTAACGTGGCTGGAAGATTTCTA

Network for GWHGAAZE000886

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	12	138	4.60E-36

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.218
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.090
	SRR3591711	White flower	0.258
	SRR3591712	Green floral bud	0.096
	SRR3591713	Yellow flower	0.312
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.079
	SRR8316897	Juvenile bud stage	0.001
	SRR8316894	Third green stage	0.255
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.051
	SRR8316898	Complete white stage	0.011
	SRR8316899	Complete white stage	0.015
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.046
	SRR8316904	Silver flowering stage	0.082
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.048
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.136
SRP132670	SRR6706286	Control	0.001
	SRR6706287	Light intensity 50%	0.001
	SRR6706288	Light intensity 20%	0.002
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.053
	CNS0095594	Slightly white alabastrum(diploid) 3	0.242
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.003
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.002
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.259
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.181
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.194
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.075
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.085
	CRR073298	Stem 2	0.469
	CRR073299	Stem 3	0.464
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.149
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.101
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.056
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000