Gene detail

Detail information of GWHGAAZE000876

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU18875.1	4.93713E-91	hypothetical protein MIMGU_mgv1a014722mg [Erythranthe guttata]
Swissprot	tr\|Q9FJI1\|KAD6_ARATH	3E-78	Adenylate kinase isoenzyme 6 homolog {ECO:0000255\|HAMAP-Rule:MF_03173}
trEMBL	tr\|A0A022PX98\|A0A022PX98_ERYGU	2E-91	Adenylate kinase isoenzyme 6 homolog {ECO:0000256\|HAMAP-Rule:MF_03173}
TAIR10	AT5G60340.1	2E-51	P-loop containing nucleoside triphosphate hydrolases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	18587524	18590312	-
GWHAAZE00000001	mRNA	18587524	18590312	-
GWHAAZE00000001	exon	18587524	18587758	-
GWHAAZE00000001	exon	18588156	18588301	-
GWHAAZE00000001	exon	18589180	18589276	-
GWHAAZE00000001	exon	18590065	18590312	-
GWHAAZE00000001	CDS	18590065	18590312	-
GWHAAZE00000001	CDS	18589180	18589276	-
GWHAAZE00000001	CDS	18588156	18588301	-
GWHAAZE00000001	CDS	18587524	18587758	-

Transcript Sequence
>GWHTAAZE000878 ATGGAGCAAAATAGCAGTAGGAAGAAGCCGAACATACTGATAACAGGAACACCAGGGACAGGGAAGACAACAACATCCTCTTCATTGTCTGAGGCTACTCAGCTCCGCCATATCAATGTTGGTGAGCTTGTCAAACACAAGAATTTGCATGATGGTTGGGACGACAAGTTAGAATGCTACATCATCAATGAAGACCTTGTAATGCCCTCTAAACCTATTTCTATATCTGCTCATAACTTTGATCCGTTTGCATCACACACCATTGAGGCTACATCTTTGTCCTCTTCTGAAACAAGTCACAAATATTTAAACGGTGCAAAGGGAAGTCAAGGAGAATTCACTGAGGTGTGCGATGAGCTTGAAGACATGATGGAAGAGGGCGGAAACATTGTGGATCATCATGGTTGTGACTTCTTTCCCGAGCGTTGGTTTGATCGCGTGGTAGTTCTTCAAACTGAAAACTCTGTCTTGTATGATCGGCTGAGTAGGAGAGGTTACACAGGACCAAAGCTTTCAAACAACATTGAATGTGAAATCTTCCAAGTTTTACTTGAAGAAGCAAAAGAAAGTTATTCTAAGGATATTGTTGTGGCACTAAAGAGCGACACCATCGATGACATGAACACGAATGTAGCAACTTTAACAGATTGGATAAGCAGTTGGACCCCGACTTCGTCTTGATCGTCATCATCACCATCACCGTCATCATCTATGTTTGTAATGTGA

Network for GWHGAAZE000876

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13238.7	AAA_18	12	180	2.40E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18532	AK6, FAP7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0004017	molecular_function	adenylate kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.164
	SRR3591706	second leaf	32.595
	SRR3591707	mature leaf	25.406
	SRR3591708	Shoot apex	69.623
	SRR3591709	Stem	40.598
	SRR3591710	White floral bud	30.208
	SRR3591711	White flower	31.347
	SRR3591712	Green floral bud	40.004
	SRR3591713	Yellow flower	27.870
SRP173429	SRR8316895	Juvenile bud stage	18.157
	SRR8316896	Juvenile bud stage	23.890
	SRR8316897	Juvenile bud stage	8.846
	SRR8316894	Third green stage	8.376
	SRR8316900	Third green stage	23.991
	SRR8316901	Third green stage	25.504
	SRR8316898	Complete white stage	8.417
	SRR8316899	Complete white stage	37.122
	SRR8316903	Complete white stage	14.461
	SRR8316902	Silver flowering stage	9.061
	SRR8316904	Silver flowering stage	12.704
	SRR8316905	Silver flowering stage	6.226
	SRR8316906	Gold flowering stage	17.022
	SRR8316907	Gold flowering stage	22.310
	SRR8316908	Gold flowering stage	17.526
SRP132670	SRR6706286	Control	19.569
	SRR6706287	Light intensity 50%	20.395
	SRR6706288	Light intensity 20%	24.851
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.205
	CNS0095593	Slightly white alabastrum(diploid) 2	32.388
	CNS0095594	Slightly white alabastrum(diploid) 3	23.779
	CNS0095595	Whole white alabastrum(diploid) 2	21.705
	CNS0095596	Whole white alabastrum(diploid) 3	19.906
	CNS0095597	Whole white alabastrum(diploid) 4	16.241
	CNS0095598	Silvery flower (diploied) 1	22.333
	CNS0095599	Silvery flower (diploied) 2	26.258
	CNS0095600	Silvery flower (diploied) 3	21.820
	CNS0095601	Golden flower (diploid) 1	16.627
	CNS0095602	Golden flower (diploid) 2	23.048
	CNS0095603	Golden flower (diploid) 3	19.493
	CNS0095604	Slightly white alabastrum(tetraploid) 1	26.116
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.751
	CNS0095606	Slightly white alabastrum(tetraploid) 3	34.041
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.869
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.221
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.638
	CNS0095610	Silvery flower (tetraploid) 1	17.484
	CNS0095611	Silvery flower (tetraploid) 2	19.122
	CNS0095612	Silvery flower (tetraploid) 3	16.096
	CNS0095613	Golden flower (tetraploid) 1	15.575
	CNS0095614	Golden flower (tetraploid) 2	17.290
	CNS0095615	Golden flower (tetraploid) 3	16.390
CRA001975	CRR073297	Stem 1	33.515
	CRR073298	Stem 2	28.114
	CRR073299	Stem 3	35.400
	CRR073300	Leaf 1	30.155
	CRR073301	Leaf 2	28.619
	CRR073302	Leaf 3	31.087
	CRR073303	Juvenile bud 1	35.845
	CRR073304	Juvenile bud 2	27.138
	CRR073305	Juvenile bud 3	31.203
	CRR073306	Third green 1	15.548
	CRR073307	Third green 2	10.003
	CRR073308	Third green 3	13.149
	CRR073309	Second white 1	21.031
	CRR073310	Second white 2	15.647
	CRR073311	Second white 3	19.831
	CRR073312	Silver flowering 1	20.037
	CRR073313	Silver flowering 2	18.007
	CRR073314	Silver flowering 3	15.784
	CRR073315	Gold flowering 1	29.611
	CRR073316	Gold flowering 2	20.749
	CRR073317	Gold flowering 3	27.747
	CRR073318	Tawny withering 1	42.191
	CRR073319	Tawny withering 2	33.448
	CRR073320	Tawny withering 3	54.684