Gene detail

Detail information of GWHGAAZE000780

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009419951.1	3.86479E-80	PREDICTED: histone H2A-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|P19177\|H2A_PETCR	3E-82	Histone H2A
trEMBL	tr\|A0A022QLV9\|A0A022QLV9_ERYGU	3E-84	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT5G02560.1	2E-47	histone H2A 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	15772267	15773425	+
GWHAAZE00000001	mRNA	15772267	15773425	+
GWHAAZE00000001	exon	15772267	15772473	+
GWHAAZE00000001	exon	15773183	15773425	+
GWHAAZE00000001	CDS	15772267	15772473	+
GWHAAZE00000001	CDS	15773183	15773425	+

Transcript Sequence
>GWHTAAZE000782 ATGGAGGCTGGTGGTAAGGCCAAGAAAGGTGCCGGAGGGAGGAAAGGCGGGCCCAGAAAGAAGTCAGTGAGCCGGTCTGTGAAGGCCGGACTCCAGTTTCCGGTGGGGAGAATTGGCCGGTACCTGAAAAAGGGTCGGTATGCTCAGAGAGTGGGAACTGGTGCTCCAGTTTATCTTGCTGCTGTTCTTGAATACCTAGCTGCTGAGGTTCTTGAGTTGGCTGGAAATGCTGCTCGTGACAACAAGAAAACCAGGATCATCCCTAGACATTTGCTGTTGGCTGTGAGGAACGATGAAGAATTGGGAAAATTGCTTGCCGGTGTAACCATAGCACATGGTGGAGTTTTGCCCAACATTAACCCAGTTTTGTTGCCAAAGAAGACTGATAAAGCTACAAAAGAACCAAAGTCTCCATCAAAGGCCACAAAATCTCCAAGGAAGGCTGCTTAG

Network for GWHGAAZE000780

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	19	96	3.40E-12
PF16211.6	Histone_H2A_C	99	133	5.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	315.781
	SRR3591706	second leaf	161.100
	SRR3591707	mature leaf	43.601
	SRR3591708	Shoot apex	1353.616
	SRR3591709	Stem	137.596
	SRR3591710	White floral bud	88.776
	SRR3591711	White flower	46.199
	SRR3591712	Green floral bud	102.561
	SRR3591713	Yellow flower	48.009
SRP173429	SRR8316895	Juvenile bud stage	91.224
	SRR8316896	Juvenile bud stage	95.608
	SRR8316897	Juvenile bud stage	36.518
	SRR8316894	Third green stage	30.428
	SRR8316900	Third green stage	71.888
	SRR8316901	Third green stage	72.811
	SRR8316898	Complete white stage	26.635
	SRR8316899	Complete white stage	98.999
	SRR8316903	Complete white stage	50.491
	SRR8316902	Silver flowering stage	18.845
	SRR8316904	Silver flowering stage	18.846
	SRR8316905	Silver flowering stage	13.367
	SRR8316906	Gold flowering stage	51.229
	SRR8316907	Gold flowering stage	51.832
	SRR8316908	Gold flowering stage	53.924
SRP132670	SRR6706286	Control	67.978
	SRR6706287	Light intensity 50%	70.602
	SRR6706288	Light intensity 20%	84.900
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	155.965
	CNS0095593	Slightly white alabastrum(diploid) 2	131.977
	CNS0095594	Slightly white alabastrum(diploid) 3	106.511
	CNS0095595	Whole white alabastrum(diploid) 2	58.291
	CNS0095596	Whole white alabastrum(diploid) 3	68.984
	CNS0095597	Whole white alabastrum(diploid) 4	45.621
	CNS0095598	Silvery flower (diploied) 1	53.215
	CNS0095599	Silvery flower (diploied) 2	60.012
	CNS0095600	Silvery flower (diploied) 3	48.985
	CNS0095601	Golden flower (diploid) 1	43.316
	CNS0095602	Golden flower (diploid) 2	50.546
	CNS0095603	Golden flower (diploid) 3	44.960
	CNS0095604	Slightly white alabastrum(tetraploid) 1	126.813
	CNS0095605	Slightly white alabastrum(tetraploid) 2	115.361
	CNS0095606	Slightly white alabastrum(tetraploid) 3	218.009
	CNS0095607	Whole white alabastrum(tetraploid) 1	50.786
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.404
	CNS0095609	Whole white alabastrum(tetraploid) 3	78.173
	CNS0095610	Silvery flower (tetraploid) 1	40.842
	CNS0095611	Silvery flower (tetraploid) 2	37.464
	CNS0095612	Silvery flower (tetraploid) 3	38.141
	CNS0095613	Golden flower (tetraploid) 1	45.138
	CNS0095614	Golden flower (tetraploid) 2	46.257
	CNS0095615	Golden flower (tetraploid) 3	41.919
CRA001975	CRR073297	Stem 1	202.354
	CRR073298	Stem 2	176.804
	CRR073299	Stem 3	361.876
	CRR073300	Leaf 1	78.671
	CRR073301	Leaf 2	77.841
	CRR073302	Leaf 3	110.051
	CRR073303	Juvenile bud 1	82.964
	CRR073304	Juvenile bud 2	86.980
	CRR073305	Juvenile bud 3	63.189
	CRR073306	Third green 1	49.401
	CRR073307	Third green 2	49.712
	CRR073308	Third green 3	47.694
	CRR073309	Second white 1	47.209
	CRR073310	Second white 2	28.757
	CRR073311	Second white 3	34.820
	CRR073312	Silver flowering 1	46.789
	CRR073313	Silver flowering 2	47.836
	CRR073314	Silver flowering 3	34.022
	CRR073315	Gold flowering 1	68.553
	CRR073316	Gold flowering 2	48.734
	CRR073317	Gold flowering 3	64.111
	CRR073318	Tawny withering 1	306.555
	CRR073319	Tawny withering 2	227.144
	CRR073320	Tawny withering 3	332.075