Gene detail

Detail information of GWHGAAZE000693

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09165.1	2.02221E-77	unnamed protein product [Coffea canephora]
Swissprot	tr\|O82391\|JOSL_ARATH	2E-59	Josephin-like protein
trEMBL	tr\|A0A068UKW2\|A0A068UKW2_COFCA	8E-78	Coffea canephora DH200=94 genomic scaffold, scaffold_36 {ECO:0000313\|EMBL:CDP09165.1}
TAIR10	AT2G29640.1	1E-49	JOSEPHIN-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	14126569	14127039	-
GWHAAZE00000001	mRNA	14126569	14127039	-
GWHAAZE00000001	exon	14126569	14127039	-
GWHAAZE00000001	CDS	14126569	14127039	-

Transcript Sequence
>GWHTAAZE000695 ATTCAGGAGAAGGATGCATTTACTCGAGCGAATTTGGATGTTATTGCCGAAAAACTTGTTCATGATGATCCAACCAAGGGAACATGGACTCCGCTTTCTGTTATCTTCAAGCCTCATCATAATGCATTCACTGGGAATTATGATGTCAATGTTTTAATTGCAGCCGTTGAAGGAAAGGGGAAGAGGGTAATTTGGCACGATCGCCGTAATGGAGTTTCTTCAATTGGGCTTGATGGTCCTGATGATAAGTTAATGGGTATTGTGCTTAATGTTCCAGTGAGAAAGTATGGTGGCATTTGGAGCAGTAGACATTGGGTTACCTTGAGAAGGATTGAGAGTGTTTGGTACAATTTGGATAGTGATTTTTCTGGTCCTTATACTTTTAACGATGTGGGAGAAGTTAGAGAATTCTTGGATAGTGTCATTCATGAAGGTGCAGAGGTACTGCTTGTGATGAACGATGAACAATGA

Network for GWHGAAZE000693

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02099.18	Josephin	4	151	6.70E-24

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	josephin

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016579	biological_process	protein deubiquitination
GO:0004843	molecular_function	thiol-dependent ubiquitin-specific protease activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.487
	SRR3591706	second leaf	13.119
	SRR3591707	mature leaf	12.856
	SRR3591708	Shoot apex	20.811
	SRR3591709	Stem	18.576
	SRR3591710	White floral bud	16.105
	SRR3591711	White flower	17.707
	SRR3591712	Green floral bud	25.179
	SRR3591713	Yellow flower	9.760
SRP173429	SRR8316895	Juvenile bud stage	11.694
	SRR8316896	Juvenile bud stage	12.233
	SRR8316897	Juvenile bud stage	7.397
	SRR8316894	Third green stage	5.828
	SRR8316900	Third green stage	23.566
	SRR8316901	Third green stage	19.595
	SRR8316898	Complete white stage	8.506
	SRR8316899	Complete white stage	27.934
	SRR8316903	Complete white stage	11.326
	SRR8316902	Silver flowering stage	6.302
	SRR8316904	Silver flowering stage	12.324
	SRR8316905	Silver flowering stage	5.029
	SRR8316906	Gold flowering stage	11.833
	SRR8316907	Gold flowering stage	13.729
	SRR8316908	Gold flowering stage	12.580
SRP132670	SRR6706286	Control	3.126
	SRR6706287	Light intensity 50%	3.369
	SRR6706288	Light intensity 20%	4.417
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.419
	CNS0095593	Slightly white alabastrum(diploid) 2	12.128
	CNS0095594	Slightly white alabastrum(diploid) 3	11.351
	CNS0095595	Whole white alabastrum(diploid) 2	14.470
	CNS0095596	Whole white alabastrum(diploid) 3	18.741
	CNS0095597	Whole white alabastrum(diploid) 4	13.547
	CNS0095598	Silvery flower (diploied) 1	19.452
	CNS0095599	Silvery flower (diploied) 2	12.189
	CNS0095600	Silvery flower (diploied) 3	19.966
	CNS0095601	Golden flower (diploid) 1	15.004
	CNS0095602	Golden flower (diploid) 2	18.242
	CNS0095603	Golden flower (diploid) 3	15.379
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.436
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.727
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.348
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.960
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.815
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.168
	CNS0095610	Silvery flower (tetraploid) 1	11.314
	CNS0095611	Silvery flower (tetraploid) 2	16.832
	CNS0095612	Silvery flower (tetraploid) 3	11.345
	CNS0095613	Golden flower (tetraploid) 1	7.041
	CNS0095614	Golden flower (tetraploid) 2	11.706
	CNS0095615	Golden flower (tetraploid) 3	5.785
CRA001975	CRR073297	Stem 1	10.295
	CRR073298	Stem 2	11.348
	CRR073299	Stem 3	5.442
	CRR073300	Leaf 1	6.821
	CRR073301	Leaf 2	9.021
	CRR073302	Leaf 3	8.013
	CRR073303	Juvenile bud 1	10.504
	CRR073304	Juvenile bud 2	6.715
	CRR073305	Juvenile bud 3	6.798
	CRR073306	Third green 1	0.816
	CRR073307	Third green 2	1.649
	CRR073308	Third green 3	2.091
	CRR073309	Second white 1	3.377
	CRR073310	Second white 2	3.640
	CRR073311	Second white 3	2.603
	CRR073312	Silver flowering 1	5.005
	CRR073313	Silver flowering 2	0.958
	CRR073314	Silver flowering 3	1.247
	CRR073315	Gold flowering 1	5.886
	CRR073316	Gold flowering 2	6.018
	CRR073317	Gold flowering 3	4.371
	CRR073318	Tawny withering 1	6.313
	CRR073319	Tawny withering 2	3.291
	CRR073320	Tawny withering 3	7.453