Gene detail

Detail information of GWHGAAZE000558

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006842573.1	2.7263E-139	hypothetical protein AMTR_s00077p00151750 [Amborella trichopoda]
Swissprot	tr\|Q9SPB3\|RL10_VITRI	1E-138	60S ribosomal protein L10
trEMBL	tr\|W1P8K5\|W1P8K5_AMBTC	1E-139	Uncharacterized protein {ECO:0000313\|EMBL:ERN04248.1}
TAIR10	AT1G26910.1	2E-103	Ribosomal protein L16p/L10e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	11216614	11219959	-
GWHAAZE00000001	mRNA	11216614	11219959	-
GWHAAZE00000001	exon	11219950	11219959	-
GWHAAZE00000001	exon	11217843	11218344	-
GWHAAZE00000001	exon	11216614	11216713	-
GWHAAZE00000001	CDS	11219950	11219959	-
GWHAAZE00000001	CDS	11217843	11218344	-
GWHAAZE00000001	CDS	11216614	11216713	-

Transcript Sequence
>GWHTAAZE000560 ATGGGAAGGAGACCTGCAAGGTGCTACCGCCAAATCAAAAACAAGCCCTACCCAAAGTCACGTTACTGCCGTGGTGTGCCAGATCCAAAGATCAGGATCTACGATGTTGGAATGAAGAAAAAGGGAGTCGACGAATTCCCCTTCTGCGTGCATTTGGTTAGCTGGGAGAAGGAGAATGTCTCCAGTGAGGCACTTGAAGCTGCACGCATTGCTTGCAACAAATACATGGCCAAGTTTTCAGGCAAGGATGCTTTCCACTTGAGGGTCAGGGTTCACCCTTTCCATGTGTTGCGTATCAACAAGATGTTGTCATGTGCTGGGGCTGATAGGCTTCAAACTGGCATGAGGGGTGCTTTTGGTAAGCCACAGGGTACATGTGCTCGTGTTAGGATTGGTCAGGTTCTCCTCTCCGTCCGTTGCAAAGATTCCAATGGGCAGCATGCCCAGGAGGCCTTGCGCCGTGCCAAGTTCAAGTTCCCTGGTCGCCAAAAGATCATTGTCAGCAGGAAGTGGGGATTTACCAAATTCAGCAGGACTGACTACGTCAAGTGGAAAGAGGAAAACCGTATCCTCAAAGATGGTGTCAATGCCAAGGTTAGTCTGCTCTGCTAA

Network for GWHGAAZE000558

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00252.19	Ribosomal_L16	12	166	3.90E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02866	RP-L10e, RPL10	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.151
	SRR3591706	second leaf	1.899
	SRR3591707	mature leaf	0.578
	SRR3591708	Shoot apex	2.449
	SRR3591709	Stem	1.436
	SRR3591710	White floral bud	21.884
	SRR3591711	White flower	10.818
	SRR3591712	Green floral bud	64.232
	SRR3591713	Yellow flower	22.545
SRP173429	SRR8316895	Juvenile bud stage	53.652
	SRR8316896	Juvenile bud stage	127.124
	SRR8316897	Juvenile bud stage	52.276
	SRR8316894	Third green stage	37.382
	SRR8316900	Third green stage	90.936
	SRR8316901	Third green stage	111.602
	SRR8316898	Complete white stage	5.679
	SRR8316899	Complete white stage	11.328
	SRR8316903	Complete white stage	6.129
	SRR8316902	Silver flowering stage	6.537
	SRR8316904	Silver flowering stage	5.457
	SRR8316905	Silver flowering stage	2.437
	SRR8316906	Gold flowering stage	12.079
	SRR8316907	Gold flowering stage	16.550
	SRR8316908	Gold flowering stage	12.252
SRP132670	SRR6706286	Control	42.909
	SRR6706287	Light intensity 50%	42.085
	SRR6706288	Light intensity 20%	37.550
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	100.109
	CNS0095593	Slightly white alabastrum(diploid) 2	64.606
	CNS0095594	Slightly white alabastrum(diploid) 3	135.608
	CNS0095595	Whole white alabastrum(diploid) 2	76.580
	CNS0095596	Whole white alabastrum(diploid) 3	99.993
	CNS0095597	Whole white alabastrum(diploid) 4	61.094
	CNS0095598	Silvery flower (diploied) 1	5.138
	CNS0095599	Silvery flower (diploied) 2	8.825
	CNS0095600	Silvery flower (diploied) 3	7.786
	CNS0095601	Golden flower (diploid) 1	4.357
	CNS0095602	Golden flower (diploid) 2	6.255
	CNS0095603	Golden flower (diploid) 3	5.496
	CNS0095604	Slightly white alabastrum(tetraploid) 1	156.649
	CNS0095605	Slightly white alabastrum(tetraploid) 2	147.938
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.322
	CNS0095607	Whole white alabastrum(tetraploid) 1	118.764
	CNS0095608	Whole white alabastrum(tetraploid) 2	98.287
	CNS0095609	Whole white alabastrum(tetraploid) 3	104.594
	CNS0095610	Silvery flower (tetraploid) 1	18.868
	CNS0095611	Silvery flower (tetraploid) 2	21.336
	CNS0095612	Silvery flower (tetraploid) 3	36.477
	CNS0095613	Golden flower (tetraploid) 1	10.763
	CNS0095614	Golden flower (tetraploid) 2	18.705
	CNS0095615	Golden flower (tetraploid) 3	9.843
CRA001975	CRR073297	Stem 1	78.017
	CRR073298	Stem 2	63.810
	CRR073299	Stem 3	77.929
	CRR073300	Leaf 1	54.050
	CRR073301	Leaf 2	65.730
	CRR073302	Leaf 3	81.415
	CRR073303	Juvenile bud 1	46.340
	CRR073304	Juvenile bud 2	51.991
	CRR073305	Juvenile bud 3	29.176
	CRR073306	Third green 1	20.768
	CRR073307	Third green 2	23.005
	CRR073308	Third green 3	20.707
	CRR073309	Second white 1	36.642
	CRR073310	Second white 2	23.992
	CRR073311	Second white 3	19.233
	CRR073312	Silver flowering 1	31.012
	CRR073313	Silver flowering 2	48.598
	CRR073314	Silver flowering 3	30.781
	CRR073315	Gold flowering 1	10.481
	CRR073316	Gold flowering 2	4.509
	CRR073317	Gold flowering 3	4.259
	CRR073318	Tawny withering 1	10.545
	CRR073319	Tawny withering 2	12.742
	CRR073320	Tawny withering 3	6.323