Gene detail

Detail information of GWHGAAZE000547

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007146924.1	8.34219E-77	hypothetical protein PHAVU_006G082300g [Phaseolus vulgaris]
Swissprot	tr\|Q9M385\|RK17_ARATH	3E-77	50S ribosomal protein L17, chloroplastic (Precursor)
trEMBL	tr\|V7BPG0\|V7BPG0_PHAVU	3E-77	Uncharacterized protein {ECO:0000313\|EMBL:ESW18918.1}
TAIR10	AT3G54210.1	1E-61	Ribosomal protein L17 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	10924021	10924371	+
GWHAAZE00000001	mRNA	10924021	10924371	+
GWHAAZE00000001	exon	10924021	10924371	+
GWHAAZE00000001	CDS	10924021	10924371	+

Transcript Sequence
>GWHTAAZE000549 ATGAGGCACGGAAGACGGGTACCTAAACTAAATAGGCCCCCGGATCAGCGCAAGGCACTTCTACGTGGCCTCACAACTCAGCTTCTAAAGTACGGACGCATCAAAACAACTAGAGCAAGAGCCAGTGCTATGAGGAAGTATGTTGACAAAATGATTACACTAGCTAAAGAGGGATCTCTTCATAAAAGGAGGCAGGCTCTTGGTTTCATTTATGAGAAACAAATTGTACACGCATTGTTTGCTGAGGTCCCAGAACGGTACGGGGAGAGGAACGGAGGTTATACAAGAATAATCAGAACACTTCCTAGGCGAGGGGACAACGCACCCATGGCCTATATCGAGCTTGTTTAG

Network for GWHGAAZE000547

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01196.20	Ribosomal_L17	20	116	7.20E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02879	RP-L17, MRPL17, rplQ	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	72.022
	SRR3591706	second leaf	194.376
	SRR3591707	mature leaf	118.568
	SRR3591708	Shoot apex	164.560
	SRR3591709	Stem	35.841
	SRR3591710	White floral bud	27.553
	SRR3591711	White flower	48.975
	SRR3591712	Green floral bud	49.599
	SRR3591713	Yellow flower	45.974
SRP173429	SRR8316895	Juvenile bud stage	56.147
	SRR8316896	Juvenile bud stage	49.852
	SRR8316897	Juvenile bud stage	35.506
	SRR8316894	Third green stage	22.269
	SRR8316900	Third green stage	86.838
	SRR8316901	Third green stage	70.340
	SRR8316898	Complete white stage	20.450
	SRR8316899	Complete white stage	51.381
	SRR8316903	Complete white stage	23.906
	SRR8316902	Silver flowering stage	12.477
	SRR8316904	Silver flowering stage	19.281
	SRR8316905	Silver flowering stage	8.601
	SRR8316906	Gold flowering stage	32.902
	SRR8316907	Gold flowering stage	27.975
	SRR8316908	Gold flowering stage	36.706
SRP132670	SRR6706286	Control	97.525
	SRR6706287	Light intensity 50%	90.542
	SRR6706288	Light intensity 20%	100.492
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.328
	CNS0095593	Slightly white alabastrum(diploid) 2	37.807
	CNS0095594	Slightly white alabastrum(diploid) 3	32.006
	CNS0095595	Whole white alabastrum(diploid) 2	33.692
	CNS0095596	Whole white alabastrum(diploid) 3	36.002
	CNS0095597	Whole white alabastrum(diploid) 4	27.575
	CNS0095598	Silvery flower (diploied) 1	51.024
	CNS0095599	Silvery flower (diploied) 2	54.613
	CNS0095600	Silvery flower (diploied) 3	50.338
	CNS0095601	Golden flower (diploid) 1	49.176
	CNS0095602	Golden flower (diploid) 2	55.492
	CNS0095603	Golden flower (diploid) 3	51.751
	CNS0095604	Slightly white alabastrum(tetraploid) 1	42.193
	CNS0095605	Slightly white alabastrum(tetraploid) 2	49.059
	CNS0095606	Slightly white alabastrum(tetraploid) 3	78.841
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.581
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.960
	CNS0095609	Whole white alabastrum(tetraploid) 3	69.380
	CNS0095610	Silvery flower (tetraploid) 1	54.649
	CNS0095611	Silvery flower (tetraploid) 2	79.095
	CNS0095612	Silvery flower (tetraploid) 3	61.407
	CNS0095613	Golden flower (tetraploid) 1	40.321
	CNS0095614	Golden flower (tetraploid) 2	52.877
	CNS0095615	Golden flower (tetraploid) 3	38.295
CRA001975	CRR073297	Stem 1	113.969
	CRR073298	Stem 2	101.432
	CRR073299	Stem 3	147.022
	CRR073300	Leaf 1	65.183
	CRR073301	Leaf 2	80.307
	CRR073302	Leaf 3	99.853
	CRR073303	Juvenile bud 1	89.033
	CRR073304	Juvenile bud 2	88.906
	CRR073305	Juvenile bud 3	78.688
	CRR073306	Third green 1	34.824
	CRR073307	Third green 2	29.269
	CRR073308	Third green 3	23.214
	CRR073309	Second white 1	48.852
	CRR073310	Second white 2	37.799
	CRR073311	Second white 3	30.581
	CRR073312	Silver flowering 1	32.565
	CRR073313	Silver flowering 2	42.747
	CRR073314	Silver flowering 3	31.339
	CRR073315	Gold flowering 1	282.286
	CRR073316	Gold flowering 2	255.455
	CRR073317	Gold flowering 3	269.686
	CRR073318	Tawny withering 1	60.409
	CRR073319	Tawny withering 2	46.914
	CRR073320	Tawny withering 3	67.150