Gene detail

Detail information of GWHGAAZE000447

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADR71263.1	8.7295E-139	60S ribosomal protein L13aA [Hevea brasiliensis]
Swissprot	tr\|Q9FKC0\|R13A4_ARATH	1E-138	60S ribosomal protein L13a-4
trEMBL	tr\|I3NMM6\|I3NMM6_HEVBR	3E-139	60S ribosomal protein L13aA {ECO:0000313\|EMBL:ADR71263.1}
TAIR10	AT5G48760.2	3E-109	Ribosomal protein L13 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	8656136	8658538	+
GWHAAZE00000001	mRNA	8656136	8658538	+
GWHAAZE00000001	exon	8656136	8656416	+
GWHAAZE00000001	exon	8657185	8657301	+
GWHAAZE00000001	exon	8657414	8657501	+
GWHAAZE00000001	exon	8658395	8658538	+
GWHAAZE00000001	CDS	8656136	8656416	+
GWHAAZE00000001	CDS	8657185	8657301	+
GWHAAZE00000001	CDS	8657414	8657501	+
GWHAAZE00000001	CDS	8658395	8658538	+

Transcript Sequence
>GWHTAAZE000449 AGAGAGGAAATGGTGTCCGGATCGGGAATCTGCGCACGGCGAGTGGTGGTCGATGCTCGCCACCACATGCTCGGCCGGTTGGCCTCTATCTTGGCCAAGGAGCTACTCAACGGCCAGAAAGTTGTCGTGGTCCGGTGCGATGAGATTTGCCTCTCCGGCGGACTCGTTCGCCAGAAAATGAAGTATCTGCGGTTCCTCCGTAAGCGTATGAACACCAAGCCTTCTCACGGTCCCATCCACTTCCGAGCTCCGGCTAAGATCCTATGGCGCACTATACGAGGGATGATTCCTCATAAGACTAAGCGTGGAGCAGCAGCTCTTGCGAGGTTGAAGGTGTATGAGGGGGTTCCTCCGCCATACGACAAGATCAAGAGGATGGTTATCCCTGATGCTCTCAAGGTTTTGAGGCTTCAGGCAGGACACAACTACTGTTTGTTGGGCCGGCTTTCATCTGAGGTTGGATGGAATCACTATGAAACCATCAAGGAGCTGGAGACGAAGAGGAAAGAGAGGGCTCAGGTGGCATATGAGAGGAAGAAGCAGCTGACGAAACTTAGGGTCAAGGCTGAGAAGGCTGCTGACGAGAAACTTGGTTCCCAACTAGAAATCCTTGCCCCTGTTAAGTATTAA

Network for GWHGAAZE000447

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00572.19	Ribosomal_L13	14	118	7.40E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02872	RP-L13Ae, RPL13A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015934	cellular_component	large ribosomal subunit
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	543.893
	SRR3591706	second leaf	273.054
	SRR3591707	mature leaf	110.619
	SRR3591708	Shoot apex	712.159
	SRR3591709	Stem	274.315
	SRR3591710	White floral bud	250.844
	SRR3591711	White flower	277.419
	SRR3591712	Green floral bud	477.523
	SRR3591713	Yellow flower	189.406
SRP173429	SRR8316895	Juvenile bud stage	325.765
	SRR8316896	Juvenile bud stage	423.679
	SRR8316897	Juvenile bud stage	229.522
	SRR8316894	Third green stage	161.878
	SRR8316900	Third green stage	573.208
	SRR8316901	Third green stage	565.373
	SRR8316898	Complete white stage	105.810
	SRR8316899	Complete white stage	492.666
	SRR8316903	Complete white stage	136.653
	SRR8316902	Silver flowering stage	105.049
	SRR8316904	Silver flowering stage	83.759
	SRR8316905	Silver flowering stage	45.483
	SRR8316906	Gold flowering stage	181.870
	SRR8316907	Gold flowering stage	182.710
	SRR8316908	Gold flowering stage	224.039
SRP132670	SRR6706286	Control	386.009
	SRR6706287	Light intensity 50%	387.474
	SRR6706288	Light intensity 20%	417.742
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	570.813
	CNS0095593	Slightly white alabastrum(diploid) 2	703.443
	CNS0095594	Slightly white alabastrum(diploid) 3	550.731
	CNS0095595	Whole white alabastrum(diploid) 2	515.439
	CNS0095596	Whole white alabastrum(diploid) 3	613.152
	CNS0095597	Whole white alabastrum(diploid) 4	404.895
	CNS0095598	Silvery flower (diploied) 1	289.358
	CNS0095599	Silvery flower (diploied) 2	255.841
	CNS0095600	Silvery flower (diploied) 3	192.975
	CNS0095601	Golden flower (diploid) 1	212.653
	CNS0095602	Golden flower (diploid) 2	173.205
	CNS0095603	Golden flower (diploid) 3	178.050
	CNS0095604	Slightly white alabastrum(tetraploid) 1	531.807
	CNS0095605	Slightly white alabastrum(tetraploid) 2	569.804
	CNS0095606	Slightly white alabastrum(tetraploid) 3	634.420
	CNS0095607	Whole white alabastrum(tetraploid) 1	362.074
	CNS0095608	Whole white alabastrum(tetraploid) 2	302.681
	CNS0095609	Whole white alabastrum(tetraploid) 3	503.385
	CNS0095610	Silvery flower (tetraploid) 1	186.727
	CNS0095611	Silvery flower (tetraploid) 2	154.895
	CNS0095612	Silvery flower (tetraploid) 3	118.222
	CNS0095613	Golden flower (tetraploid) 1	110.017
	CNS0095614	Golden flower (tetraploid) 2	171.189
	CNS0095615	Golden flower (tetraploid) 3	91.507
CRA001975	CRR073297	Stem 1	407.177
	CRR073298	Stem 2	437.251
	CRR073299	Stem 3	465.080
	CRR073300	Leaf 1	438.406
	CRR073301	Leaf 2	474.759
	CRR073302	Leaf 3	586.605
	CRR073303	Juvenile bud 1	475.032
	CRR073304	Juvenile bud 2	372.063
	CRR073305	Juvenile bud 3	372.720
	CRR073306	Third green 1	67.074
	CRR073307	Third green 2	89.220
	CRR073308	Third green 3	85.924
	CRR073309	Second white 1	69.176
	CRR073310	Second white 2	45.291
	CRR073311	Second white 3	37.435
	CRR073312	Silver flowering 1	57.088
	CRR073313	Silver flowering 2	89.857
	CRR073314	Silver flowering 3	67.978
	CRR073315	Gold flowering 1	145.544
	CRR073316	Gold flowering 2	171.797
	CRR073317	Gold flowering 3	158.188
	CRR073318	Tawny withering 1	414.198
	CRR073319	Tawny withering 2	321.532
	CRR073320	Tawny withering 3	405.719