Gene detail

Detail information of GWHGAAZE000403

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002301833.2	6.0923E-103	hypothetical protein POPTR_0002s25530g [Populus trichocarpa]
Swissprot	tr\|Q9FQA3\|GST23_MAIZE	9E-72	Glutathione transferase GST 23
trEMBL	tr\|B9GRA4\|B9GRA4_POPTR	2E-103	Uncharacterized protein {ECO:0000313\|EMBL:EEE81106.2}
TAIR10	AT2G29420.1	2E-50	glutathione S-transferase tau 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	7790285	7791678	-
GWHAAZE00000001	mRNA	7790285	7791678	-
GWHAAZE00000001	exon	7790285	7790650	-
GWHAAZE00000001	exon	7791370	7791678	-
GWHAAZE00000001	CDS	7791370	7791678	-
GWHAAZE00000001	CDS	7790285	7790650	-

Transcript Sequence
>GWHTAAZE000405 ATGGACGAAGTGAAATTAATAGGAACTTGGGCAAGTCCATTTAGTTACAGAGTAATATGGGCTCTGAAACTAAAAGGAGTTAAATACGAATATGTAGAAGAGGATCTTTCAAACAAGAGTGAGATGCTCTTAAAGTATAATCCAGTTTATAAAAAGATACCAGTTCTTGTTCATGCTGGTAGACCAATAGCAGATTCCTCGGTTATTCTTGAGTATATTGAAGAGACATGGCCAAATAATCCCTTGCTTCCAAGTAACCCTTATGAGAAGGCTCAGGCCAGGTTCTGGATTAAGTTTGTGGAAGATAAGGGGAGTGCATTTGTTAATGTCTTCCGAACAGTAGGAGAAGAACAAGTGAAGGCAACTAAAGAAGCCAAAGAAGTGATGAGATTTATAGAAGAGCATGCATTACTAGAAGGAGAAAATAAATTCTTTCGCGGCGACAGAATTGGGTTGATTGACATAGTTTTCGGATGGTATGCTGGTTGGCTCCCATCTTTCGAAGAAGCCAATGGTGTAAAATTGCTAGACCCCGATAGCTTCCCCAAATTACAGGCCTGGATCGAGAATTTCAAGGAAGATGATGTTATTAGAGAGAACCTTCCGAATTCCAATGAATTGCTGCCATATTTCAAATGCTTGAGGGAGAAGTTCATTGCCTTGGCATCACAATAA

Network for GWHGAAZE000403

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02798.21	GST_N	4	74	9.00E-16
PF00043.26	GST_C	116	191	2.00E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00799	GST, gst	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Metabolism of xenobiotics by cytochrome P450	map00980
		Drug metabolism - cytochrome P450	map00982
		Drug metabolism - other enzymes	map00983
		Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.185
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.547
	SRR3591711	White flower	0.606
	SRR3591712	Green floral bud	0.065
	SRR3591713	Yellow flower	2.385
SRP173429	SRR8316895	Juvenile bud stage	0.087
	SRR8316896	Juvenile bud stage	0.099
	SRR8316897	Juvenile bud stage	0.066
	SRR8316894	Third green stage	0.168
	SRR8316900	Third green stage	0.131
	SRR8316901	Third green stage	0.168
	SRR8316898	Complete white stage	0.115
	SRR8316899	Complete white stage	0.145
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.167
	SRR8316904	Silver flowering stage	0.954
	SRR8316905	Silver flowering stage	0.346
	SRR8316906	Gold flowering stage	7.363
	SRR8316907	Gold flowering stage	0.104
	SRR8316908	Gold flowering stage	14.955
SRP132670	SRR6706286	Control	0.384
	SRR6706287	Light intensity 50%	0.036
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.355
	CNS0095594	Slightly white alabastrum(diploid) 3	0.631
	CNS0095595	Whole white alabastrum(diploid) 2	0.110
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.057
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.207
	CNS0095601	Golden flower (diploid) 1	1.086
	CNS0095602	Golden flower (diploid) 2	0.826
	CNS0095603	Golden flower (diploid) 3	0.255
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.180
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.870
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.262
	CNS0095613	Golden flower (tetraploid) 1	4.215
	CNS0095614	Golden flower (tetraploid) 2	1.779
	CNS0095615	Golden flower (tetraploid) 3	0.265
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.023
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.089
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.058
	CRR073309	Second white 1	0.701
	CRR073310	Second white 2	0.174
	CRR073311	Second white 3	1.280
	CRR073312	Silver flowering 1	0.140
	CRR073313	Silver flowering 2	1.293
	CRR073314	Silver flowering 3	1.013
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.854
	CRR073319	Tawny withering 2	7.447
	CRR073320	Tawny withering 3	0.000