Gene detail

Detail information of GWHGAAZE000366

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP26493.1	1.89424E-97	hypothetical protein JCGZ_17651 [Jatropha curcas]
Swissprot	tr\|Q9SFC6\|GDIR_ARATH	4E-53	Rho GDP-dissociation inhibitor 1
trEMBL	tr\|A0A067JUJ6\|A0A067JUJ6_JATCU	7E-98	Uncharacterized protein {ECO:0000313\|EMBL:KDP26493.1}
TAIR10	AT3G07880.1	5E-41	Immunoglobulin E-set superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	7133034	7134362	+
GWHAAZE00000001	mRNA	7133034	7134362	+
GWHAAZE00000001	exon	7133034	7133109	+
GWHAAZE00000001	exon	7133223	7133444	+
GWHAAZE00000001	exon	7133721	7133845	+
GWHAAZE00000001	exon	7134294	7134362	+
GWHAAZE00000001	CDS	7133034	7133109	+
GWHAAZE00000001	CDS	7133223	7133444	+
GWHAAZE00000001	CDS	7133721	7133845	+
GWHAAZE00000001	CDS	7134294	7134362	+

Transcript Sequence
>GWHTAAZE000368 ATGGATGTGCAGGATGATGAGAGCTTACGGAGGTGGAAAGAGAAGCTTCTTGGTTGCGTGGAAAGTGATTTAAATGGACAAATGAACCCCGAAGTCAAATTCCACTCAATAGGAATCATATCGGACGATATTGGCGAGATTAATACTCCATTACCGATTGACGAGAGTCATAGTGGTCAGCTCCTCTTTACGCTCAAAGAGGGATCTCCGTACCAATTTAAGCTTACATTCACTGTTCTTCACAACATTGTCTCTGGCCTCGCCTACACAAACACAGTGTGTAAAGGAGGACTACAAGTTGATCGCAGCAAAGGAATGTTGGGTACATTTGCTCCTCATAGAGAACCATATGTACATACCTTAGATGAAGAGACTACTCCATCCGGTGTGCTTGCAAGAGGAATATACACGGCTACGCTTAAGTTTGAAGATGATGATAGAAGGTGTCACATGGAGCTCTGCTATTCCTTTGAAATCAAGAAGAGCAGATAG

Network for GWHGAAZE000366

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02115.18	Rho_GDI	4	161	7.00E-59

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12462	ARHGDI, RHOGDI	Vasopressin-regulated water reabsorption	map04962
K12462	ARHGDI, RHOGDI	Neurotrophin signaling pathway	map04722

Gene Ontology

GO term	Ontology	Name
GO:0005737	cellular_component	cytoplasm
GO:0005094	molecular_function	Rho GDP-dissociation inhibitor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.400
	SRR3591706	second leaf	8.931
	SRR3591707	mature leaf	8.624
	SRR3591708	Shoot apex	22.095
	SRR3591709	Stem	20.049
	SRR3591710	White floral bud	16.024
	SRR3591711	White flower	23.659
	SRR3591712	Green floral bud	13.072
	SRR3591713	Yellow flower	15.806
SRP173429	SRR8316895	Juvenile bud stage	20.796
	SRR8316896	Juvenile bud stage	24.507
	SRR8316897	Juvenile bud stage	13.472
	SRR8316894	Third green stage	8.468
	SRR8316900	Third green stage	25.472
	SRR8316901	Third green stage	25.545
	SRR8316898	Complete white stage	4.952
	SRR8316899	Complete white stage	28.576
	SRR8316903	Complete white stage	6.818
	SRR8316902	Silver flowering stage	9.207
	SRR8316904	Silver flowering stage	9.840
	SRR8316905	Silver flowering stage	3.750
	SRR8316906	Gold flowering stage	26.479
	SRR8316907	Gold flowering stage	20.143
	SRR8316908	Gold flowering stage	23.149
SRP132670	SRR6706286	Control	4.474
	SRR6706287	Light intensity 50%	5.802
	SRR6706288	Light intensity 20%	5.288
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.346
	CNS0095593	Slightly white alabastrum(diploid) 2	37.334
	CNS0095594	Slightly white alabastrum(diploid) 3	22.247
	CNS0095595	Whole white alabastrum(diploid) 2	24.705
	CNS0095596	Whole white alabastrum(diploid) 3	16.952
	CNS0095597	Whole white alabastrum(diploid) 4	16.963
	CNS0095598	Silvery flower (diploied) 1	30.948
	CNS0095599	Silvery flower (diploied) 2	31.036
	CNS0095600	Silvery flower (diploied) 3	15.116
	CNS0095601	Golden flower (diploid) 1	36.266
	CNS0095602	Golden flower (diploid) 2	27.632
	CNS0095603	Golden flower (diploid) 3	25.002
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.614
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.057
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.613
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.083
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.307
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.809
	CNS0095610	Silvery flower (tetraploid) 1	4.145
	CNS0095611	Silvery flower (tetraploid) 2	7.211
	CNS0095612	Silvery flower (tetraploid) 3	17.454
	CNS0095613	Golden flower (tetraploid) 1	2.023
	CNS0095614	Golden flower (tetraploid) 2	4.970
	CNS0095615	Golden flower (tetraploid) 3	1.996
CRA001975	CRR073297	Stem 1	58.797
	CRR073298	Stem 2	47.842
	CRR073299	Stem 3	43.350
	CRR073300	Leaf 1	36.425
	CRR073301	Leaf 2	36.718
	CRR073302	Leaf 3	41.659
	CRR073303	Juvenile bud 1	40.001
	CRR073304	Juvenile bud 2	13.622
	CRR073305	Juvenile bud 3	28.406
	CRR073306	Third green 1	16.828
	CRR073307	Third green 2	14.628
	CRR073308	Third green 3	12.200
	CRR073309	Second white 1	35.289
	CRR073310	Second white 2	36.728
	CRR073311	Second white 3	34.153
	CRR073312	Silver flowering 1	36.995
	CRR073313	Silver flowering 2	33.142
	CRR073314	Silver flowering 3	33.956
	CRR073315	Gold flowering 1	17.178
	CRR073316	Gold flowering 2	21.080
	CRR073317	Gold flowering 3	12.547
	CRR073318	Tawny withering 1	33.911
	CRR073319	Tawny withering 2	32.816
	CRR073320	Tawny withering 3	23.953