Gene detail

Detail information of GWHGAAZE000353

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004246952.1	1.15461E-53	PREDICTED: NAC domain-containing protein 21/22-like [Solanum lycopersicum]
Swissprot	tr\|Q9S851\|NAC31_ARATH	2E-37	Protein CUP-SHAPED COTYLEDON 3
trEMBL	tr\|K4CSJ2\|K4CSJ2_SOLLC	4E-54	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc09g025310.2.1}
TAIR10	AT4G28530.1	2E-43	NAC domain containing protein 74

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	6810466	6811045	-
GWHAAZE00000001	mRNA	6810466	6811045	-
GWHAAZE00000001	exon	6810466	6810731	-
GWHAAZE00000001	exon	6811042	6811045	-
GWHAAZE00000001	CDS	6811042	6811045	-
GWHAAZE00000001	CDS	6810466	6810731	-

Transcript Sequence
>GWHTAAZE000353 ATGGAGGTGGCAAAGCTCAATTCAACTGAATGGTACTTCTTCAGCTTTCGAGATCGTAAGTACGCGACTGGATACCGAACCAATAGGGCAACGACATGTGGATACTGGAAGGCAACTGGGAAGGATCGGACGGTGGTGGAACCGAAGAGCCGGGCGATCGTAGGGATGAGAAAGACACTGGTGTTCTACAAAAATAGAGCTCCAAATGGGGTTAAAACTGGTTGGATCATGCATGAGTTTCGCTTAGAGAACCCTCATATTCCTCCTAAG

Network for GWHGAAZE000353

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	5	82	3.50E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.107
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	3.108
	SRR3591710	White floral bud	2.660
	SRR3591711	White flower	1.504
	SRR3591712	Green floral bud	0.259
	SRR3591713	Yellow flower	1.746
SRP173429	SRR8316895	Juvenile bud stage	1.155
	SRR8316896	Juvenile bud stage	5.244
	SRR8316897	Juvenile bud stage	0.881
	SRR8316894	Third green stage	2.443
	SRR8316900	Third green stage	0.284
	SRR8316901	Third green stage	2.167
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.159
	SRR8316903	Complete white stage	0.190
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.260
	SRR8316908	Gold flowering stage	0.200
SRP132670	SRR6706286	Control	1.130
	SRR6706287	Light intensity 50%	1.938
	SRR6706288	Light intensity 20%	0.499
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.585
	CNS0095593	Slightly white alabastrum(diploid) 2	0.089
	CNS0095594	Slightly white alabastrum(diploid) 3	2.949
	CNS0095595	Whole white alabastrum(diploid) 2	1.426
	CNS0095596	Whole white alabastrum(diploid) 3	0.017
	CNS0095597	Whole white alabastrum(diploid) 4	0.100
	CNS0095598	Silvery flower (diploied) 1	0.647
	CNS0095599	Silvery flower (diploied) 2	1.666
	CNS0095600	Silvery flower (diploied) 3	1.358
	CNS0095601	Golden flower (diploid) 1	0.682
	CNS0095602	Golden flower (diploid) 2	0.976
	CNS0095603	Golden flower (diploid) 3	1.030
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.471
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.219
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.755
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.659
	CNS0095610	Silvery flower (tetraploid) 1	0.157
	CNS0095611	Silvery flower (tetraploid) 2	0.748
	CNS0095612	Silvery flower (tetraploid) 3	0.614
	CNS0095613	Golden flower (tetraploid) 1	1.110
	CNS0095614	Golden flower (tetraploid) 2	0.546
	CNS0095615	Golden flower (tetraploid) 3	1.791
CRA001975	CRR073297	Stem 1	0.554
	CRR073298	Stem 2	6.572
	CRR073299	Stem 3	2.837
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.224
	CRR073302	Leaf 3	1.225
	CRR073303	Juvenile bud 1	0.209
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.136
	CRR073306	Third green 1	0.328
	CRR073307	Third green 2	0.492
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.371
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.192
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.513
	CRR073319	Tawny withering 2	1.548
	CRR073320	Tawny withering 3	0.235