Gene detail

Detail information of GWHGAAZE000338

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011083023.1	2.14638E-90	PREDICTED: actin-depolymerizing factor-like [Sesamum indicum]
Swissprot	tr\|Q8SAG3\|ADF_VITVI	1E-84	Actin-depolymerizing factor
trEMBL	tr\|I3S1M0\|I3S1M0_LOTJA	7E-90	Uncharacterized protein {ECO:0000313\|EMBL:AFK34162.1}
TAIR10	AT2G31200.1	4E-56	actin depolymerizing factor 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	6624233	6626034	-
GWHAAZE00000001	mRNA	6624233	6626034	-
GWHAAZE00000001	exon	6624233	6624383	-
GWHAAZE00000001	exon	6624732	6624997	-
GWHAAZE00000001	exon	6626014	6626034	-
GWHAAZE00000001	CDS	6626014	6626034	-
GWHAAZE00000001	CDS	6624732	6624997	-
GWHAAZE00000001	CDS	6624233	6624383	-

Transcript Sequence
>GWHTAAZE000338 ATGTCCTTCAGAATCAGAGGGCCAAATGCTTCTTCAGGCATGGGTGTTGCTGATCACAGCAAAAAAATGTTTATGGAACTGAAGAGGAAGAAGGTTCACAGGTACGTGATTTTTAAGGTTGATGAGAAGAAGAACGAGGTTGTTGTGGAGAAGACCGGTGGTCCTGCTGAAAGCTATGATGATTTCACCTCGGCCTTGCCCGATAATGATTGCCGATATGCTGTCTATGATTTTGATTTTGTGACTTCTGAGAATTGTCAAAAGAGCAAGATATTCTTCATTGCCTGGTCTCCGGAAATATCCCGAATCCGGTCCAAGATGTTGTATGCTACATCCAAAGAAAGGTTCAGACGTGAGCTTGACGGTATCCATTATGAGATTCAAGCTACCGATCCTACAGAGATGGATCTTGAAGTTATCAGAGACCGTGCACACTAA

Network for GWHGAAZE000338

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	22	142	8.00E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.837
	SRR3591706	second leaf	9.335
	SRR3591707	mature leaf	55.145
	SRR3591708	Shoot apex	11.901
	SRR3591709	Stem	71.195
	SRR3591710	White floral bud	64.067
	SRR3591711	White flower	148.420
	SRR3591712	Green floral bud	25.668
	SRR3591713	Yellow flower	68.949
SRP173429	SRR8316895	Juvenile bud stage	15.697
	SRR8316896	Juvenile bud stage	12.980
	SRR8316897	Juvenile bud stage	18.386
	SRR8316894	Third green stage	10.043
	SRR8316900	Third green stage	69.245
	SRR8316901	Third green stage	44.760
	SRR8316898	Complete white stage	55.723
	SRR8316899	Complete white stage	72.567
	SRR8316903	Complete white stage	68.266
	SRR8316902	Silver flowering stage	102.159
	SRR8316904	Silver flowering stage	81.230
	SRR8316905	Silver flowering stage	35.319
	SRR8316906	Gold flowering stage	91.045
	SRR8316907	Gold flowering stage	111.122
	SRR8316908	Gold flowering stage	90.470
SRP132670	SRR6706286	Control	34.592
	SRR6706287	Light intensity 50%	29.808
	SRR6706288	Light intensity 20%	26.576
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.305
	CNS0095593	Slightly white alabastrum(diploid) 2	38.135
	CNS0095594	Slightly white alabastrum(diploid) 3	36.627
	CNS0095595	Whole white alabastrum(diploid) 2	39.150
	CNS0095596	Whole white alabastrum(diploid) 3	34.999
	CNS0095597	Whole white alabastrum(diploid) 4	34.439
	CNS0095598	Silvery flower (diploied) 1	52.765
	CNS0095599	Silvery flower (diploied) 2	74.266
	CNS0095600	Silvery flower (diploied) 3	107.460
	CNS0095601	Golden flower (diploid) 1	58.215
	CNS0095602	Golden flower (diploid) 2	71.414
	CNS0095603	Golden flower (diploid) 3	60.999
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.695
	CNS0095605	Slightly white alabastrum(tetraploid) 2	31.477
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.484
	CNS0095607	Whole white alabastrum(tetraploid) 1	47.933
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.825
	CNS0095609	Whole white alabastrum(tetraploid) 3	40.935
	CNS0095610	Silvery flower (tetraploid) 1	157.119
	CNS0095611	Silvery flower (tetraploid) 2	86.180
	CNS0095612	Silvery flower (tetraploid) 3	69.429
	CNS0095613	Golden flower (tetraploid) 1	44.983
	CNS0095614	Golden flower (tetraploid) 2	57.157
	CNS0095615	Golden flower (tetraploid) 3	46.429
CRA001975	CRR073297	Stem 1	16.512
	CRR073298	Stem 2	16.437
	CRR073299	Stem 3	15.392
	CRR073300	Leaf 1	21.726
	CRR073301	Leaf 2	32.514
	CRR073302	Leaf 3	38.614
	CRR073303	Juvenile bud 1	50.656
	CRR073304	Juvenile bud 2	49.270
	CRR073305	Juvenile bud 3	39.367
	CRR073306	Third green 1	64.927
	CRR073307	Third green 2	58.698
	CRR073308	Third green 3	67.055
	CRR073309	Second white 1	77.215
	CRR073310	Second white 2	58.090
	CRR073311	Second white 3	32.281
	CRR073312	Silver flowering 1	25.564
	CRR073313	Silver flowering 2	23.160
	CRR073314	Silver flowering 3	15.415
	CRR073315	Gold flowering 1	33.468
	CRR073316	Gold flowering 2	37.402
	CRR073317	Gold flowering 3	21.174
	CRR073318	Tawny withering 1	36.986
	CRR073319	Tawny withering 2	63.434
	CRR073320	Tawny withering 3	41.473