Gene detail

Detail information of GWHGAAZE000337

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGS80335.1	1.14545E-97	ethylene response factor [Actinidia eriantha]
Swissprot	tr\|Q8LDC8\|ERF92_ARATH	4E-71	Ethylene-responsive transcription factor 1B
trEMBL	tr\|S5VSG8\|S5VSG8_ACTER	4E-98	Ethylene response factor {ECO:0000313\|EMBL:AGS80335.1}
TAIR10	AT3G23240.1	4E-45	ethylene response factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	6621294	6621989	+
GWHAAZE00000001	mRNA	6621294	6621989	+
GWHAAZE00000001	exon	6621294	6621989	+
GWHAAZE00000001	CDS	6621294	6621989	+

Transcript Sequence
>GWHTAAZE000337 ATGGATTCCTCTTTCACTCAATACCAGAATTCAAATTACTCCCCGGAATCCTCTCTCTCGTGGGACGAACTTCTTTTCCAACACAACTCCCTTCCTTTTAATTTCGACGACACAGAAGAAATGCTCCTCTATGGGGTCGTAGCCGAGGGAATCCTATCCTCCTCCGATTCCAATGCCTCTGGTGGCGGAATCCATGACGAATTCAATTCCAATAACGACGAAAAACCAGATTCCTTGGTTGAAGTAAAAGAAGAGGAGGTGAATTCTAGAGCGGAGGAGCAAAAGCAGGAAAAATCATATAGAGGAGTTAGGACACGACCGTGGGGGAAATTCGCAGCGGAAATAAGGGATTCCACGAGAAATGGAGTCCGGGTCTGGCTCGGCACGTTTGACAGTGCCGAAGCAGCAGCCATGGCCTATGACCAGGCGGCGTTTTCTACTAGAGGATCGACTGCGATCCTCAATTTTCCGGTGGAAAGAGTAAAGGAGTCACTTCGAGAAATGAATTATGGTTTTGAAGATGGTTGTTCCCCCGTAATGGCATTGAAAAAGAGACACTCAATGAGAAAGAAATCATTGAGTAGGAAAAATAAAGTTAAAGAGGCAAAAATGGACAATGTGGTGGTATTAGAGGATTTGGGAGCTGAGTACTTGGAGGCACTACTGAGTTCATCCGAGAGTTTTTCTACTTGGTGA

Network for GWHGAAZE000337

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	99	149	1.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
K14516	ERF1	MAPK signaling pathway - plant	map04016
K14516	ERF1	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.746
	SRR3591706	second leaf	0.809
	SRR3591707	mature leaf	3.632
	SRR3591708	Shoot apex	0.442
	SRR3591709	Stem	1.407
	SRR3591710	White floral bud	0.095
	SRR3591711	White flower	0.296
	SRR3591712	Green floral bud	0.192
	SRR3591713	Yellow flower	0.229
SRP173429	SRR8316895	Juvenile bud stage	0.165
	SRR8316896	Juvenile bud stage	0.522
	SRR8316897	Juvenile bud stage	0.320
	SRR8316894	Third green stage	0.188
	SRR8316900	Third green stage	0.549
	SRR8316901	Third green stage	0.978
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.590
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.105
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.210
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.750
SRP132670	SRR6706286	Control	1.667
	SRR6706287	Light intensity 50%	1.414
	SRR6706288	Light intensity 20%	1.559
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.635
	CNS0095593	Slightly white alabastrum(diploid) 2	0.131
	CNS0095594	Slightly white alabastrum(diploid) 3	0.820
	CNS0095595	Whole white alabastrum(diploid) 2	0.470
	CNS0095596	Whole white alabastrum(diploid) 3	0.120
	CNS0095597	Whole white alabastrum(diploid) 4	0.351
	CNS0095598	Silvery flower (diploied) 1	0.359
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.160
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.083
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.506
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.602
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.287
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.378
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.221
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.231
	CNS0095610	Silvery flower (tetraploid) 1	0.114
	CNS0095611	Silvery flower (tetraploid) 2	0.245
	CNS0095612	Silvery flower (tetraploid) 3	0.261
	CNS0095613	Golden flower (tetraploid) 1	0.040
	CNS0095614	Golden flower (tetraploid) 2	0.172
	CNS0095615	Golden flower (tetraploid) 3	0.100
CRA001975	CRR073297	Stem 1	0.258
	CRR073298	Stem 2	0.272
	CRR073299	Stem 3	0.193
	CRR073300	Leaf 1	0.943
	CRR073301	Leaf 2	0.420
	CRR073302	Leaf 3	2.204
	CRR073303	Juvenile bud 1	0.808
	CRR073304	Juvenile bud 2	0.823
	CRR073305	Juvenile bud 3	0.705
	CRR073306	Third green 1	0.094
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.071
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.661
	CRR073316	Gold flowering 2	4.644
	CRR073317	Gold flowering 3	6.678
	CRR073318	Tawny withering 1	0.647
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.483