Gene detail

Detail information of GWHGAAZE000243

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011079871.1	1.008E-105	PREDICTED: 40S ribosomal protein S18-like [Sesamum indicum]
COG	YP_447903.1	5E-42	30S ribosomal protein S13P
Swissprot	tr\|P34788\|RS18_ARATH	2E-102	40S ribosomal protein S18
trEMBL	tr\|A0A022RPP2\|A0A022RPP2_ERYGU	8E-106	Uncharacterized protein {ECO:0000313\|EMBL:EYU40915.1}
TAIR10	AT1G34030.1	2E-71	Ribosomal protein S13/S18 family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	4779170	4780622	+
GWHAAZE00000001	mRNA	4779170	4780622	+
GWHAAZE00000001	exon	4779170	4779330	+
GWHAAZE00000001	exon	4780193	4780381	+
GWHAAZE00000001	exon	4780517	4780622	+
GWHAAZE00000001	CDS	4779170	4779330	+
GWHAAZE00000001	CDS	4780193	4780381	+
GWHAAZE00000001	CDS	4780517	4780622	+

Transcript Sequence
>GWHTAAZE000243 TCGCTGGTAGCAAATGAGGACTTTCAACATATTCTTCGTGTACAGAACACGAACGTAGATGGAAAACAGAAGATTATGTTTGCAATGACCTCCATCAAGGGTATTGGTCGTCGTTTCGCCAACATCGTCTGCAAGAAAGCTGATATCGACATGAACAAACGGGCTGGTGAACTCTCAAATGCTGAGATTGATAGCTTGATGGTGATTGTTGCAAATCCTCGCCAGTTCAAGATCCCAGACTGGTTCCTGAACAGGAAGAAGGATTACAAGGATGGAAAATATTCTCAAGTGACATCAAATGCACTGGACATGAAACTGAGGGATGATCTTGAGCGCTTGAAGAAGATTAGGAACCATCGAGGTCTGCGTCACTACTGGGGTCTCAGAGTCCGTGGACAACATACTAAGACTACTGGCAGAAGGGGAAAGACTGTCGGTGTCTCCAAGAAGCGATAA

Network for GWHGAAZE000243

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00416.23	Ribosomal_S13	13	141	1.80E-55

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02964	RP-S18e, RPS18	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003676	molecular_function	nucleic acid binding
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	733.141
	SRR3591706	second leaf	347.728
	SRR3591707	mature leaf	336.108
	SRR3591708	Shoot apex	1044.348
	SRR3591709	Stem	498.774
	SRR3591710	White floral bud	371.657
	SRR3591711	White flower	432.480
	SRR3591712	Green floral bud	889.077
	SRR3591713	Yellow flower	266.295
SRP173429	SRR8316895	Juvenile bud stage	324.874
	SRR8316896	Juvenile bud stage	466.962
	SRR8316897	Juvenile bud stage	255.086
	SRR8316894	Third green stage	203.048
	SRR8316900	Third green stage	753.875
	SRR8316901	Third green stage	693.142
	SRR8316898	Complete white stage	122.769
	SRR8316899	Complete white stage	810.651
	SRR8316903	Complete white stage	182.257
	SRR8316902	Silver flowering stage	100.336
	SRR8316904	Silver flowering stage	93.159
	SRR8316905	Silver flowering stage	42.689
	SRR8316906	Gold flowering stage	172.457
	SRR8316907	Gold flowering stage	157.964
	SRR8316908	Gold flowering stage	208.131
SRP132670	SRR6706286	Control	1003.127
	SRR6706287	Light intensity 50%	1002.746
	SRR6706288	Light intensity 20%	1176.078
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	687.437
	CNS0095593	Slightly white alabastrum(diploid) 2	825.820
	CNS0095594	Slightly white alabastrum(diploid) 3	633.011
	CNS0095595	Whole white alabastrum(diploid) 2	669.417
	CNS0095596	Whole white alabastrum(diploid) 3	808.008
	CNS0095597	Whole white alabastrum(diploid) 4	644.089
	CNS0095598	Silvery flower (diploied) 1	339.915
	CNS0095599	Silvery flower (diploied) 2	294.439
	CNS0095600	Silvery flower (diploied) 3	228.004
	CNS0095601	Golden flower (diploid) 1	321.108
	CNS0095602	Golden flower (diploid) 2	242.656
	CNS0095603	Golden flower (diploid) 3	237.801
	CNS0095604	Slightly white alabastrum(tetraploid) 1	693.012
	CNS0095605	Slightly white alabastrum(tetraploid) 2	660.673
	CNS0095606	Slightly white alabastrum(tetraploid) 3	819.936
	CNS0095607	Whole white alabastrum(tetraploid) 1	434.027
	CNS0095608	Whole white alabastrum(tetraploid) 2	474.246
	CNS0095609	Whole white alabastrum(tetraploid) 3	760.993
	CNS0095610	Silvery flower (tetraploid) 1	206.404
	CNS0095611	Silvery flower (tetraploid) 2	217.751
	CNS0095612	Silvery flower (tetraploid) 3	112.297
	CNS0095613	Golden flower (tetraploid) 1	118.167
	CNS0095614	Golden flower (tetraploid) 2	144.447
	CNS0095615	Golden flower (tetraploid) 3	88.959
CRA001975	CRR073297	Stem 1	575.046
	CRR073298	Stem 2	588.525
	CRR073299	Stem 3	608.549
	CRR073300	Leaf 1	718.202
	CRR073301	Leaf 2	763.245
	CRR073302	Leaf 3	874.460
	CRR073303	Juvenile bud 1	940.150
	CRR073304	Juvenile bud 2	561.928
	CRR073305	Juvenile bud 3	734.649
	CRR073306	Third green 1	53.302
	CRR073307	Third green 2	66.502
	CRR073308	Third green 3	73.401
	CRR073309	Second white 1	103.276
	CRR073310	Second white 2	74.967
	CRR073311	Second white 3	37.628
	CRR073312	Silver flowering 1	65.808
	CRR073313	Silver flowering 2	85.038
	CRR073314	Silver flowering 3	71.751
	CRR073315	Gold flowering 1	382.669
	CRR073316	Gold flowering 2	396.852
	CRR073317	Gold flowering 3	465.948
	CRR073318	Tawny withering 1	636.840
	CRR073319	Tawny withering 2	512.358
	CRR073320	Tawny withering 3	593.346