Gene detail

Detail information of GWHGAAZE000203

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP03574.1	9.06332E-83	unnamed protein product [Coffea canephora]
Swissprot	tr\|O65759\|H2AX_CICAR	1E-77	Histone H2AX
trEMBL	tr\|A0A068U5X3\|A0A068U5X3_COFCA	3E-83	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT1G54690.1	6E-48	gamma histone variant H2AX

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	4084001	4084510	-
GWHAAZE00000001	mRNA	4084001	4084510	-
GWHAAZE00000001	exon	4084001	4084222	-
GWHAAZE00000001	exon	4084304	4084510	-
GWHAAZE00000001	CDS	4084304	4084510	-
GWHAAZE00000001	CDS	4084001	4084222	-

Transcript Sequence
>GWHTAAZE000203 ATGAGTTCAACAACAACGGCAACTAAATCAGTTTCCGGTAGAGGCAAAACCAGGGGAACAAAATCAGTCTCCCGGTCCCAAAAGGCTGGTCTGCAGTTCCCCGTCGGCCGAGTTGCCCGGTTCCTCAAAGCCGGCCGATATGCCCAGCGTGTTGGCTCTGGTTCTCCGGTATACCTCTCTGCGGTTCTTGAATACCTTGCTGCCGAGGTATTGGAGCTTGCTGGAAATGCTGCGAGGGATAATAAGAAGAGTAGAATTACGCCAAGGCATGTTCAGTTGGCTGTGAGGAATGATGAGGAGTTTAGCAAGTTGTTGGGAAATGTTACTATTGCCAACGGAGGTGTTTTGCCTAATATACATCAGAATCTGTTACCGAAGAAGGTTGCACCTGGGAAGGCTGAAGTTGGGTCTGTTTCTCAGGAGTTTTAG

Network for GWHGAAZE000203

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	18	96	7.00E-15
PF16211.6	Histone_H2A_C	99	132	2.00E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	66.706
	SRR3591706	second leaf	25.362
	SRR3591707	mature leaf	2.409
	SRR3591708	Shoot apex	435.622
	SRR3591709	Stem	20.828
	SRR3591710	White floral bud	8.591
	SRR3591711	White flower	3.516
	SRR3591712	Green floral bud	9.287
	SRR3591713	Yellow flower	0.484
SRP173429	SRR8316895	Juvenile bud stage	18.298
	SRR8316896	Juvenile bud stage	13.294
	SRR8316897	Juvenile bud stage	6.404
	SRR8316894	Third green stage	3.623
	SRR8316900	Third green stage	1.225
	SRR8316901	Third green stage	1.837
	SRR8316898	Complete white stage	0.325
	SRR8316899	Complete white stage	2.785
	SRR8316903	Complete white stage	2.614
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.353
	SRR8316905	Silver flowering stage	0.183
	SRR8316906	Gold flowering stage	1.143
	SRR8316907	Gold flowering stage	0.606
	SRR8316908	Gold flowering stage	0.969
SRP132670	SRR6706286	Control	1.234
	SRR6706287	Light intensity 50%	1.570
	SRR6706288	Light intensity 20%	1.811
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.466
	CNS0095593	Slightly white alabastrum(diploid) 2	15.750
	CNS0095594	Slightly white alabastrum(diploid) 3	19.840
	CNS0095595	Whole white alabastrum(diploid) 2	5.025
	CNS0095596	Whole white alabastrum(diploid) 3	1.140
	CNS0095597	Whole white alabastrum(diploid) 4	2.278
	CNS0095598	Silvery flower (diploied) 1	6.149
	CNS0095599	Silvery flower (diploied) 2	6.998
	CNS0095600	Silvery flower (diploied) 3	1.599
	CNS0095601	Golden flower (diploid) 1	4.222
	CNS0095602	Golden flower (diploid) 2	1.288
	CNS0095603	Golden flower (diploid) 3	1.891
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.070
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.787
	CNS0095606	Slightly white alabastrum(tetraploid) 3	29.904
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.655
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.824
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.585
	CNS0095610	Silvery flower (tetraploid) 1	0.545
	CNS0095611	Silvery flower (tetraploid) 2	1.613
	CNS0095612	Silvery flower (tetraploid) 3	4.685
	CNS0095613	Golden flower (tetraploid) 1	5.889
	CNS0095614	Golden flower (tetraploid) 2	0.585
	CNS0095615	Golden flower (tetraploid) 3	0.774
CRA001975	CRR073297	Stem 1	44.166
	CRR073298	Stem 2	39.452
	CRR073299	Stem 3	69.801
	CRR073300	Leaf 1	1.414
	CRR073301	Leaf 2	2.981
	CRR073302	Leaf 3	3.355
	CRR073303	Juvenile bud 1	3.491
	CRR073304	Juvenile bud 2	1.715
	CRR073305	Juvenile bud 3	1.233
	CRR073306	Third green 1	2.514
	CRR073307	Third green 2	3.479
	CRR073308	Third green 3	3.091
	CRR073309	Second white 1	0.376
	CRR073310	Second white 2	1.559
	CRR073311	Second white 3	1.985
	CRR073312	Silver flowering 1	5.577
	CRR073313	Silver flowering 2	5.034
	CRR073314	Silver flowering 3	0.297
	CRR073315	Gold flowering 1	4.715
	CRR073316	Gold flowering 2	1.958
	CRR073317	Gold flowering 3	3.495
	CRR073318	Tawny withering 1	60.022
	CRR073319	Tawny withering 2	32.967
	CRR073320	Tawny withering 3	56.328