Gene detail

Detail information of GWHGAAZE000119

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008359413.1	8.9662E-176	PREDICTED: pectinesterase-like [Malus domestica]
COG	YP_004318102.1	2E-46	pectinesterase
Swissprot	tr\|P85076\|PME_ACTDE	2E-161	Pectinesterase
trEMBL	tr\|B9GSC5\|B9GSC5_POPTR	2E-175	Pectinesterase {ECO:0000256\|RuleBase:RU000589}
TAIR10	AT4G02320.1	3E-114	Plant invertase/pectin methylesterase inhibitor superfamily

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	2269652	2271853	-
GWHAAZE00000001	mRNA	2269652	2271853	-
GWHAAZE00000001	exon	2269652	2270346	-
GWHAAZE00000001	exon	2271679	2271853	-
GWHAAZE00000001	CDS	2271679	2271853	-
GWHAAZE00000001	CDS	2269652	2270346	-

Transcript Sequence
>GWHTAAZE000119 ATGAGTAAGACGAGATTTGTGATATACATAAAAGCCGGGGCGTATTATGAGAATGTGGAGGTGTATAGGAACAAAAGTATGTTGATGTTCGTTGGAGATGGGATAGGGAAGACACTGGTAAAGGGTAACCGGAATGTTGTTGATGGCTCCACTACTTTCCGTTCTGCTACCGTTGCTGTGGTTGGAGATGGATTCCTAGCCAAAGGCATCACATTCGAGAACTACGCCGGTCCGAGCAAGCACCAAGCCGTAGCCTTAAGGAGCGGTTCAGACCTATCGGCCTTCTACCAGTGCAGCTTCGTAGGCTACCAAGACACCCTTTACGTCCACTCCCTCCGCCAGTACTACCGGGACTGCGACATTTATGGCACTGTTGACTTCGTGTTCGGCAATGCTGCTGTGGTCCTCCAAAACTGCAATCTATACGCCCGTAAACCTAACGAAAACCAAACAAACATTTTCACTGCCCAAGGAAGGGAAGACCCCAACCAAAACACTGGCCTTTCTATTCTAAACTGCAAAATTGCTTCGGCCTCGGATTTAATTCCAGTGCAAGCGTCTTTTAGGACGTTTCTTGGTCGGCCTTGGAGAGAATACTCGAGGACTGTCGTGATTAGATCTTACATTGGGGATCTGGTTGACCCAGCTGGGTGGTTGGAGTGGTCGGGTGAGTTTGGGTTGAATACATTGTATTATGGTGAGTATATGAATAGGGGGCCGGGTTCAAATACTAGTGCGAGAGTGACTTGGGTCGGTTATAGGGTGATTAATGACTCGGCCGAGGCAGCTCAGTTTAGCGCTGGGAATTTGATACAGGGTGGTGACTGGCTAAATACTACTAGTTTTCCTTACTTTCTGAGTTTAACTTGA

Network for GWHGAAZE000119

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01095.20	Pectinesterase	2	273	5.10E-132

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	28.674
	SRR3591706	second leaf	11.636
	SRR3591707	mature leaf	0.278
	SRR3591708	Shoot apex	40.941
	SRR3591709	Stem	5.721
	SRR3591710	White floral bud	1.847
	SRR3591711	White flower	0.113
	SRR3591712	Green floral bud	4.680
	SRR3591713	Yellow flower	0.011
SRP173429	SRR8316895	Juvenile bud stage	5.269
	SRR8316896	Juvenile bud stage	4.320
	SRR8316897	Juvenile bud stage	1.352
	SRR8316894	Third green stage	2.022
	SRR8316900	Third green stage	3.623
	SRR8316901	Third green stage	2.763
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	3.034
	SRR8316903	Complete white stage	0.322
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.088
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.324
	SRR6706287	Light intensity 50%	2.607
	SRR6706288	Light intensity 20%	2.911
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.814
	CNS0095593	Slightly white alabastrum(diploid) 2	10.116
	CNS0095594	Slightly white alabastrum(diploid) 3	8.055
	CNS0095595	Whole white alabastrum(diploid) 2	5.113
	CNS0095596	Whole white alabastrum(diploid) 3	3.352
	CNS0095597	Whole white alabastrum(diploid) 4	4.663
	CNS0095598	Silvery flower (diploied) 1	1.770
	CNS0095599	Silvery flower (diploied) 2	1.280
	CNS0095600	Silvery flower (diploied) 3	0.839
	CNS0095601	Golden flower (diploid) 1	0.460
	CNS0095602	Golden flower (diploid) 2	0.204
	CNS0095603	Golden flower (diploid) 3	0.407
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.041
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.149
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.968
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.717
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.662
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.271
	CNS0095610	Silvery flower (tetraploid) 1	0.082
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.168
	CNS0095613	Golden flower (tetraploid) 1	0.129
	CNS0095614	Golden flower (tetraploid) 2	0.060
	CNS0095615	Golden flower (tetraploid) 3	0.072
CRA001975	CRR073297	Stem 1	8.873
	CRR073298	Stem 2	7.189
	CRR073299	Stem 3	9.456
	CRR073300	Leaf 1	3.706
	CRR073301	Leaf 2	3.906
	CRR073302	Leaf 3	3.503
	CRR073303	Juvenile bud 1	0.985
	CRR073304	Juvenile bud 2	0.646
	CRR073305	Juvenile bud 3	3.018
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.093
	CRR073308	Third green 3	0.045
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.404
	CRR073313	Silver flowering 2	0.059
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.084
	CRR073316	Gold flowering 2	1.850
	CRR073317	Gold flowering 3	1.431
	CRR073318	Tawny withering 1	4.750
	CRR073319	Tawny withering 2	5.157
	CRR073320	Tawny withering 3	7.248