Gene detail

Detail information of GWHGAAZE000114

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGU44838.1	5.49787E-74	ethylene responsive factor [Capsicum chinense]
Swissprot	tr\|O22259\|ERF71_ARATH	2E-39	Ethylene-responsive transcription factor ERF071
trEMBL	tr\|T1WZI3\|T1WZI3_CAPCH	2E-74	Ethylene responsive factor {ECO:0000313\|EMBL:AGU44838.1}
TAIR10	AT2G47520.1	1E-26	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	2227179	2228060	-
GWHAAZE00000001	mRNA	2227179	2228060	-
GWHAAZE00000001	exon	2227179	2227822	-
GWHAAZE00000001	exon	2227898	2228060	-
GWHAAZE00000001	CDS	2227898	2228060	-
GWHAAZE00000001	CDS	2227179	2227822	-

Transcript Sequence
>GWHTAAZE000114 ATGTGTGGAGGCTCAATCCTCTCCAATCTCATCCCTCAGATTCGTGGTCGCGGCCTCTCCTCCTCCGCCGACTTCCGCTCCAATGCTTTCGACTCCTACCTAAATCACTTAACCAAAAAAGATTCCTCCAACCTCAAAAGACCCCAACCACATTCAAATACAGATGATGATGATGATGTTACGCATGTGGAAAAGAAGCCAAAGAGGGAGAGAAAGAACCTCTACAGGGGAATAAGGCAGCGCCCGTGGGGAAAATGGGCAGCCGAGATACGTGATCCTCGCAAAGGTGTTAGGGTTTGGCTGGGTACCTTCAACACTGCCGAAGAAGCTGCCAGAGCCTATGATAGAGAAGCCCGTAAAATCAGAGGAAAGAAAGCCAAAGTTAACTTCCCAAATGAGGATACTACTGATTACAACCCTCCTCTTAAAACCCAACATCAATCTCACATAGCCAACTTTCCTCCTCCTCAATCCTACATTCAATTTACTGATAATCTGAAGCAAAATAATACTTCATATCCCTGTAATGGGTTTTATTCTGAAGCAGCTTCTGGATTTGATAAGGTGAAGGAGGAAGAAGAGAAAGCAGAATTGATTGAAAATAAAGAAACAGAGGAGGGAAGTAACGAAGTGGAGAAATTGTCTCAAGAGCTTATGGCTTATGAATCTTATATGAAGTTCTATGAGATTCCGTATTACGAAGGACAGTCGGCAAATCCAGCGACGGAGAGTGTTGTGGTCGGTGGATCTATGGAACTTTGGAGCTTTGATGACGAAGCTTCTGTGGTGACCCCTTGTGCTCTGTAA

Network for GWHGAAZE000114

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	75	123	7.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	221.292
	SRR3591706	second leaf	9.681
	SRR3591707	mature leaf	5.850
	SRR3591708	Shoot apex	71.098
	SRR3591709	Stem	146.101
	SRR3591710	White floral bud	38.438
	SRR3591711	White flower	34.150
	SRR3591712	Green floral bud	15.101
	SRR3591713	Yellow flower	46.893
SRP173429	SRR8316895	Juvenile bud stage	82.865
	SRR8316896	Juvenile bud stage	93.090
	SRR8316897	Juvenile bud stage	112.909
	SRR8316894	Third green stage	14.732
	SRR8316900	Third green stage	22.262
	SRR8316901	Third green stage	33.158
	SRR8316898	Complete white stage	15.978
	SRR8316899	Complete white stage	20.847
	SRR8316903	Complete white stage	32.627
	SRR8316902	Silver flowering stage	29.402
	SRR8316904	Silver flowering stage	50.448
	SRR8316905	Silver flowering stage	32.847
	SRR8316906	Gold flowering stage	75.434
	SRR8316907	Gold flowering stage	100.036
	SRR8316908	Gold flowering stage	104.828
SRP132670	SRR6706286	Control	17.189
	SRR6706287	Light intensity 50%	15.300
	SRR6706288	Light intensity 20%	12.255
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	42.596
	CNS0095593	Slightly white alabastrum(diploid) 2	44.775
	CNS0095594	Slightly white alabastrum(diploid) 3	48.340
	CNS0095595	Whole white alabastrum(diploid) 2	18.772
	CNS0095596	Whole white alabastrum(diploid) 3	8.896
	CNS0095597	Whole white alabastrum(diploid) 4	12.871
	CNS0095598	Silvery flower (diploied) 1	101.497
	CNS0095599	Silvery flower (diploied) 2	71.390
	CNS0095600	Silvery flower (diploied) 3	93.469
	CNS0095601	Golden flower (diploid) 1	179.031
	CNS0095602	Golden flower (diploid) 2	232.103
	CNS0095603	Golden flower (diploid) 3	231.247
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.237
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.378
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.756
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.397
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.689
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.014
	CNS0095610	Silvery flower (tetraploid) 1	38.985
	CNS0095611	Silvery flower (tetraploid) 2	72.845
	CNS0095612	Silvery flower (tetraploid) 3	21.097
	CNS0095613	Golden flower (tetraploid) 1	211.296
	CNS0095614	Golden flower (tetraploid) 2	92.339
	CNS0095615	Golden flower (tetraploid) 3	363.667
CRA001975	CRR073297	Stem 1	77.672
	CRR073298	Stem 2	74.725
	CRR073299	Stem 3	69.140
	CRR073300	Leaf 1	51.484
	CRR073301	Leaf 2	87.465
	CRR073302	Leaf 3	66.704
	CRR073303	Juvenile bud 1	34.795
	CRR073304	Juvenile bud 2	24.712
	CRR073305	Juvenile bud 3	88.860
	CRR073306	Third green 1	7.520
	CRR073307	Third green 2	17.186
	CRR073308	Third green 3	14.550
	CRR073309	Second white 1	3.191
	CRR073310	Second white 2	2.113
	CRR073311	Second white 3	4.069
	CRR073312	Silver flowering 1	16.596
	CRR073313	Silver flowering 2	22.470
	CRR073314	Silver flowering 3	36.066
	CRR073315	Gold flowering 1	6.988
	CRR073316	Gold flowering 2	4.037
	CRR073317	Gold flowering 3	4.773
	CRR073318	Tawny withering 1	155.472
	CRR073319	Tawny withering 2	49.229
	CRR073320	Tawny withering 3	361.775