Gene detail

Detail information of GWHGAAZE000111

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002516973.1	7.5901E-131	60S ribosomal protein L19, putative [Ricinus communis]
COG	YP_183936.1	1E-36	50S ribosomal protein L19e
Swissprot	tr\|Q9LUQ6\|RL192_ARATH	4E-122	60S ribosomal protein L19-2
trEMBL	tr\|B9RTA4\|B9RTA4_RICCO	3E-131	Ribosomal protein L19 {ECO:0000256\|RuleBase:RU000574}
TAIR10	AT1G02780.1	2E-87	Ribosomal protein L19e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	2191475	2193532	-
GWHAAZE00000001	mRNA	2191475	2193532	-
GWHAAZE00000001	exon	2191475	2191531	-
GWHAAZE00000001	exon	2191684	2191997	-
GWHAAZE00000001	exon	2192371	2192493	-
GWHAAZE00000001	exon	2193421	2193532	-
GWHAAZE00000001	CDS	2193421	2193532	-
GWHAAZE00000001	CDS	2192371	2192493	-
GWHAAZE00000001	CDS	2191684	2191997	-
GWHAAZE00000001	CDS	2191475	2191531	-

Transcript Sequence
>GWHTAAZE000111 ATGGTGTCGCTGAAGCTACAGAAGCGGCTTGCCGCTAGTGTTCTCAAGTGCGGAAGGGGAAAGGTTTGGCTTGATCCGAATGAAGGCAGTGAAATCTCCATGGCCAACTCTCGCCAGAACATCAGAAAGCTGGTCAAGGATGGCTTTATTATCAGGAAACCAACTAAGATTCACTCCCGTTCTAGGGCTCGTCGAATGAAGGAAGCCAAGAGAAAGGGCCGTCATTCTGGATATGGTAAAAGGAAAGGTACTAGGGAAGCAAGGTTGCCCACAAAAATCCTGTGGATGAGGAGGATGAGGGTCCTTAGGCGCTTGCTCCGCAAATACAGGGAATCAAAGAAGATCGACAAACACATGTACCATGACATGTACATGAAGGTGAAAGGTAATGTCTTTAAGAATAAGCGTGTGCTGATGGAGAGCATTCACAAATCCAAGGCTGAGAAGGCTAGGGAGAAGACTTTGTCTGACCAGTTTGAGGCTAAGCGAGCAAAGAACAAGGCAAGCAGGGAAAGAAAGTTTGCCAGGAGAGAGGAACGTTTGGCCCAGGGACCAGTAGAGAGGGCACCACAACCAGCAGCAGCAACAGCTCCTGCCCAATCGGCA

Network for GWHGAAZE000111

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01280.21	Ribosomal_L19e	4	145	3.80E-64

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02885	RP-L19e, RPL19	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0022625	cellular_component	cytosolic large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	693.019
	SRR3591706	second leaf	350.412
	SRR3591707	mature leaf	418.062
	SRR3591708	Shoot apex	880.545
	SRR3591709	Stem	550.529
	SRR3591710	White floral bud	463.789
	SRR3591711	White flower	477.706
	SRR3591712	Green floral bud	696.850
	SRR3591713	Yellow flower	344.815
SRP173429	SRR8316895	Juvenile bud stage	347.089
	SRR8316896	Juvenile bud stage	494.217
	SRR8316897	Juvenile bud stage	259.587
	SRR8316894	Third green stage	215.103
	SRR8316900	Third green stage	634.281
	SRR8316901	Third green stage	635.249
	SRR8316898	Complete white stage	150.105
	SRR8316899	Complete white stage	619.081
	SRR8316903	Complete white stage	243.356
	SRR8316902	Silver flowering stage	199.744
	SRR8316904	Silver flowering stage	223.090
	SRR8316905	Silver flowering stage	141.923
	SRR8316906	Gold flowering stage	386.977
	SRR8316907	Gold flowering stage	439.882
	SRR8316908	Gold flowering stage	465.177
SRP132670	SRR6706286	Control	904.403
	SRR6706287	Light intensity 50%	905.710
	SRR6706288	Light intensity 20%	976.559
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	567.872
	CNS0095593	Slightly white alabastrum(diploid) 2	605.898
	CNS0095594	Slightly white alabastrum(diploid) 3	509.932
	CNS0095595	Whole white alabastrum(diploid) 2	513.807
	CNS0095596	Whole white alabastrum(diploid) 3	545.221
	CNS0095597	Whole white alabastrum(diploid) 4	430.800
	CNS0095598	Silvery flower (diploied) 1	432.632
	CNS0095599	Silvery flower (diploied) 2	349.371
	CNS0095600	Silvery flower (diploied) 3	333.409
	CNS0095601	Golden flower (diploid) 1	421.206
	CNS0095602	Golden flower (diploid) 2	370.694
	CNS0095603	Golden flower (diploid) 3	382.859
	CNS0095604	Slightly white alabastrum(tetraploid) 1	528.243
	CNS0095605	Slightly white alabastrum(tetraploid) 2	505.310
	CNS0095606	Slightly white alabastrum(tetraploid) 3	622.624
	CNS0095607	Whole white alabastrum(tetraploid) 1	374.906
	CNS0095608	Whole white alabastrum(tetraploid) 2	351.751
	CNS0095609	Whole white alabastrum(tetraploid) 3	537.536
	CNS0095610	Silvery flower (tetraploid) 1	373.246
	CNS0095611	Silvery flower (tetraploid) 2	326.626
	CNS0095612	Silvery flower (tetraploid) 3	236.693
	CNS0095613	Golden flower (tetraploid) 1	302.370
	CNS0095614	Golden flower (tetraploid) 2	340.621
	CNS0095615	Golden flower (tetraploid) 3	294.581
CRA001975	CRR073297	Stem 1	722.987
	CRR073298	Stem 2	722.787
	CRR073299	Stem 3	748.232
	CRR073300	Leaf 1	786.051
	CRR073301	Leaf 2	810.939
	CRR073302	Leaf 3	862.220
	CRR073303	Juvenile bud 1	713.633
	CRR073304	Juvenile bud 2	673.248
	CRR073305	Juvenile bud 3	675.329
	CRR073306	Third green 1	236.053
	CRR073307	Third green 2	257.034
	CRR073308	Third green 3	258.947
	CRR073309	Second white 1	176.015
	CRR073310	Second white 2	152.709
	CRR073311	Second white 3	101.916
	CRR073312	Silver flowering 1	141.369
	CRR073313	Silver flowering 2	188.656
	CRR073314	Silver flowering 3	138.874
	CRR073315	Gold flowering 1	380.044
	CRR073316	Gold flowering 2	417.906
	CRR073317	Gold flowering 3	370.671
	CRR073318	Tawny withering 1	563.891
	CRR073319	Tawny withering 2	506.395
	CRR073320	Tawny withering 3	542.753