Gene detail

Detail information of GWHGAAZE000004

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP28137.1	5.12589E-62	hypothetical protein JCGZ_13908 [Jatropha curcas]
COG	YP_006643112.1	2E-10	translocator protein
Swissprot	tr\|O82245\|TSPO_ARATH	1E-47	Translocator protein homolog
trEMBL	tr\|A0A067JW57\|A0A067JW57_JATCU	2E-62	Uncharacterized protein {ECO:0000313\|EMBL:KDP28137.1}
TAIR10	AT2G47770.1	3E-39	TSPO(outer membrane tryptophan-rich sensory protein)-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	84961	85989	+
GWHAAZE00000001	mRNA	84961	85989	+
GWHAAZE00000001	exon	84961	85053	+
GWHAAZE00000001	exon	85507	85989	+
GWHAAZE00000001	CDS	84961	85053	+
GWHAAZE00000001	CDS	85507	85989	+

Transcript Sequence
>GWHTAAZE000004 ATGCTATGCGTGCTTCAACAACTGAATCGGCACCAAAGACTTATGTGGACATCCCCTTGTTTCTCTCTTCATGTGTATGCTTGCTTCCGCCAGAAAAGACCTTCCTCCTCTGCAACACGTGGACTCCGCTCATTGGCCATAGCAGTCGCCCTCCCTCTCTCTCTGACCTTAGCCGACATCTCCTTACTCGGCTCGAGTCACGGCTACCACGCCGCTTCGCCCAAGCCCTTCTGGTTCCCGCCTCTATGGGCATTACACCTCACTTCCATGATTTACACTTCCTTGATGGGTATCTCGGCTTGGCTTGTTTGGGCTCAAGGTGGCTTCCATAAGGACCCCATTGCAGCGGCTCTGTACTTGGCTCAGCTCGTGCTCAGCTTGGCGTGGGGGCCGGTCGCGTTGTCGTCGGGTGAGGGTCGGGTCGGTTTAGCGGTTTGTTTGGCTACCTTGGGGGTATTGGCTGCGTGTTACAGGATGTTTGGGAAGGTGAATCCGGTAGCTGGGGAGCTGGTTAAGCCTTGTTTGGCATGGGCTGGCTTTCTTACTCTTGTCAATCTTAAGTTGGTTTACCTTTGA

Network for GWHGAAZE000004

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03073.16	TspO_MBR	48	189	4.50E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05770	TSPO, BZRP	Neuroactive ligand-receptor interaction	map04080
		Apoptosis - fly	map04214
		Cholesterol metabolism	map04979

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.157
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.258
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.081
	SRR3591712	Green floral bud	0.129
	SRR3591713	Yellow flower	0.138
SRP173429	SRR8316895	Juvenile bud stage	0.523
	SRR8316896	Juvenile bud stage	0.679
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.257
	SRR8316900	Third green stage	0.814
	SRR8316901	Third green stage	1.079
	SRR8316898	Complete white stage	0.149
	SRR8316899	Complete white stage	1.636
	SRR8316903	Complete white stage	0.051
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.119
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.592
	SRR6706287	Light intensity 50%	0.631
	SRR6706288	Light intensity 20%	0.868
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.356
	CNS0095593	Slightly white alabastrum(diploid) 2	0.692
	CNS0095594	Slightly white alabastrum(diploid) 3	0.107
	CNS0095595	Whole white alabastrum(diploid) 2	1.111
	CNS0095596	Whole white alabastrum(diploid) 3	0.729
	CNS0095597	Whole white alabastrum(diploid) 4	0.751
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.528
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.102
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.698
	CRR073298	Stem 2	0.810
	CRR073299	Stem 3	0.472
	CRR073300	Leaf 1	0.253
	CRR073301	Leaf 2	0.809
	CRR073302	Leaf 3	0.967
	CRR073303	Juvenile bud 1	1.514
	CRR073304	Juvenile bud 2	0.870
	CRR073305	Juvenile bud 3	1.148
	CRR073306	Third green 1	0.253
	CRR073307	Third green 2	0.244
	CRR073308	Third green 3	0.132
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.131
	CRR073315	Gold flowering 1	0.081
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.402
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000