Gene detail

Detail information of GWHGAAEX012365/evm.TU.scaffold_42.193

Functional Annotation

Database	Orthologs	E value	Annotation
COG	gi\|482886638\|ref\|YP_007883811.1\|	1.00E-18	aspartate aminotransferase AspC [Mannheimia haemolytica M42548]
KOG	KOG1411	7.00E-49	Aspartate aminotransferase/Glutamic oxaloacetic transaminase AAT1/GOT2
nr	gi\|743799817\|ref\|XP_010925610.1\|	4.39E-49	PREDICTED: aspartate aminotransferase, mitochondrial [Elaeis guineensis]
Swissprot	tr\|P46643\|AAT1_ARATH	2.00E-49	Aspartate aminotransferase, mitochondrial (Precursor)
trEMBL	tr\|W5H2J5\|W5H2J5_WHEAT	4.00E-49	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_6DS_4CA5BD5EE.1}
TAIR	AT2G30970	7.00E-49	aspartate aminotransferase 1

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000050	5312428	5313827	+

Transcript Sequence
>GWHTAAEX012365 ATGGCGGGCCGAATCATCGGAATGCGAAACACTCTGCGCGAAAACCTCGAAAAACTGGGGTCTGATCTGTCGTGGGAACACATGACTGACCAGATAGGAATGTTCTGTTTCAGTGGTCTGACGCCAGAGCAAGTTGATCGTTTGACGAATGAGTTTCATATATATATGACCAGGAATGGTCGAATCAGCATGGCTGGGGTTACTACAGGCAATGTCGCCTATTTGGCTAATGCTATTCATGAGGTTACGAAAGCTGCTTAA

Network for GWHGAAEX012365

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module12	AUX/IAA_EAR_family AUX/IAA_EAR_family CYTOCHROME_P582_Family CYTOCHROME_P582_Family GO:0004725 protein tyrosine phosphatase activity GOslim:molecular_function GO:0008171 O-methyltransferase activity GOslim:molecular_function GO:0009733 response to auxin GOslim:biological_process GO:0010215 cellulose microfibril organization GOslim:biological_process GO:0015079 potassium ion transmembrane transporter activity GOslim:molecular_function GO:0031225 anchored component of membrane GOslim:cellular_component GO:0071805 potassium ion transmembrane transport GOslim:biological_process map02020 Two-component system map04075 Plant hormone signal transduction map04975 Fat digestion and absorption Protein Kinases RLK-Pelle_WAK Family Protein Kinases RLK-Pelle_WAK Family Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family Transcription factor C2H2 Family Transcription factor C2H2 Family Transcription factor SBP Family Transcription factor SBP Family

Module ID

Function Annotation

Module12

AUX/IAA_EAR_family AUX/IAA_EAR_family
CYTOCHROME_P582_Family CYTOCHROME_P582_Family
GO:0004725 protein tyrosine phosphatase activity GOslim:molecular_function
GO:0008171 O-methyltransferase activity GOslim:molecular_function
GO:0009733 response to auxin GOslim:biological_process
GO:0010215 cellulose microfibril organization GOslim:biological_process
GO:0015079 potassium ion transmembrane transporter activity GOslim:molecular_function
GO:0031225 anchored component of membrane GOslim:cellular_component
GO:0071805 potassium ion transmembrane transport GOslim:biological_process
map02020 Two-component system
map04075 Plant hormone signal transduction
map04975 Fat digestion and absorption
Protein Kinases RLK-Pelle_WAK Family Protein Kinases RLK-Pelle_WAK Family
Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family
Transcription factor C2H2 Family Transcription factor C2H2 Family
Transcription factor SBP Family Transcription factor SBP Family

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00155.20	Aminotran_1_2	1	79	9.20E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14455	GOT2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of antibiotics	map01130
		Carbon metabolism	map01200
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		Carbon fixation in photosynthetic organisms	map00710
		Pyrimidine metabolism	map00240
		Cysteine and methionine metabolism	map00270
		Arginine biosynthesis	map00220
		Arginine and proline metabolism	map00330
		Tyrosine metabolism	map00350
		Phenylalanine metabolism	map00360
		Tryptophan metabolism	map00380
		Isoquinoline alkaloid biosynthesis	map00950
		Fat digestion and absorption	map04975

Gene Ontology

GO term	Ontology	Name
GO:0009058	Biological Process	biosynthetic process
GO:0030170	Molecular Function	pyridoxal phosphate binding
GO:0003824	Molecular Function	catalytic activity

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	23.500
SRP064423	SRR2545915	Juvenile tuber	16.600
SRP108465	SRR5643513	five period of Gastrodia elata	17.490
	SRR5643514	five period of Gastrodia elata	36.310
	SRR5643515	five period of Gastrodia elata	8.750
	SRR5643524	five period of Gastrodia elata	12.680
	SRR5643525	five period of Gastrodia elata	31.770
	SRR5643528	five period of Gastrodia elata	15.400
	SRR5643658	five period of Gastrodia elata	15.970
	SRR5643659	five period of Gastrodia elata	12.030
	SRR5643660	five period of Gastrodia elata	8.710
	SRR5643661	five period of Gastrodia elata	5.540
	SRR5643662	five period of Gastrodia elata	16.190
	SRR5643663	five period of Gastrodia elata	17.100
	SRR5643664	five period of Gastrodia elata	16.200
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	51.640
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	27.350
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	81.300
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	39.010
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	70.100
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	68.200
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	82.020
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	70.740
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	131.160
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	88.680
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	72.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	72.000
SRP279888	Gastro	Gastrodia elata tuber	50.53
	Juven	Juvenile tuber	22.21
	Mother_Gastro	Mother tuber of Gastrodia elata	159.79
	Mother_Juven	Mother tuber of Juvenile	26.94