Gene detail

Detail information of GWHGAAEX009225/evm.TU.scaffold_24.76

Functional Annotation

Database	Orthologs	E value	Annotation
KOG	KOG0027	2.00E-27	Calmodulin and related proteins (EF-Hand superfamily)
nr	gi\|695080067\|ref\|XP_009387474.1\|	1.53E-38	PREDICTED: calmodulin-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q8RZB5\|CML10_ORYSJ	9.00E-16	Probable calcium-binding protein CML10
trEMBL	tr\|C6T3P6\|C6T3P6_SOYBN	4.00E-34	Putative uncharacterized protein {ECO:0000313\|EMBL:ACU16284.1}
TAIR	AT5G49480	2.00E-27	Ca2+-binding protein 1

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000021	3809296	3809733	+

Transcript Sequence
>GWHTAAEX009225 ATGCAGGAAATGCGGCCAGCATTCGACGTGCTGGATGCTAACGGAGACGGGCGCATAAGCCGGGAAGACCTGCGCGCCTTCTTCTCGTCTGGCTACGCGCCAGCGTCCGATAACGTGCTGGCGGCGATGATCTCGGCCGCGGACGCGGACAAGAACGGCTTCGTGGAGTTCGAGGAGTTCGAGGGCGTGCTCCCCGGCGATGACGTCGGCGCCGGAATCATGGAGGAGGTCTTTCGAATGATGGACGGCGACGGAGACGGGAAGGTGGGATTCCACGACCTCAAGCGCTATTTGTCCTCCGTCGGAATTCCCGCCGACGATGATGATGTTCTCGACATGATCCGTTCTGCCGCCTCCAACCATTCCTCTGCCTCCATCGGCCTCCATGATCTCCTGCGATTCCTTTCTCTTCATCCTGCCGTCTGCATCTCCTCATGA

Network for GWHGAAEX009225

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module1	GO:0003677 DNA binding GOslim:molecular_function GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds GOslim:molecular_function GO:0004857 enzyme inhibitor activity GOslim:molecular_function GO:0005975 carbohydrate metabolic process GOslim:biological_process GO:0006355 regulation of transcription, DNA-templated GOslim:biological_process GO:0006629 lipid metabolic process GOslim:biological_process GO:0008081 phosphoric diester hydrolase activity GOslim:molecular_function GO:0008234 cysteine-type peptidase activity GOslim:molecular_function GO:0009055 electron carrier activity GOslim:molecular_function GO:0015018 galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity GOslim:molecular_function GO:0015035 protein disulfide oxidoreductase activity GOslim:molecular_function GO:0015267 channel activity GOslim:molecular_function GO:0016020 membrane GOslim:cellular_component GO:0016702 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen GOslim:molecular_function GO:0016757 transferase activity, transferring glycosyl groups GOslim:molecular_function GO:0046556 alpha-L-arabinofuranosidase activity GOslim:molecular_function GO:0046983 protein dimerization activity GOslim:molecular_function Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family Transcription factor C2C2-Dof Family Transcription factor C2C2-Dof Family Transcription factor NAC Family Transcription factor NAC Family

Module ID

Function Annotation

Module1

GO:0003677 DNA binding GOslim:molecular_function
GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds GOslim:molecular_function
GO:0004857 enzyme inhibitor activity GOslim:molecular_function
GO:0005975 carbohydrate metabolic process GOslim:biological_process
GO:0006355 regulation of transcription, DNA-templated GOslim:biological_process
GO:0006629 lipid metabolic process GOslim:biological_process
GO:0008081 phosphoric diester hydrolase activity GOslim:molecular_function
GO:0008234 cysteine-type peptidase activity GOslim:molecular_function
GO:0009055 electron carrier activity GOslim:molecular_function
GO:0015018 galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity GOslim:molecular_function
GO:0015035 protein disulfide oxidoreductase activity GOslim:molecular_function
GO:0015267 channel activity GOslim:molecular_function
GO:0016020 membrane GOslim:cellular_component
GO:0016702 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen GOslim:molecular_function
GO:0016757 transferase activity, transferring glycosyl groups GOslim:molecular_function
GO:0046556 alpha-L-arabinofuranosidase activity GOslim:molecular_function
GO:0046983 protein dimerization activity GOslim:molecular_function
Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family
Transcription factor C2C2-Dof Family Transcription factor C2C2-Dof Family
Transcription factor NAC Family Transcription factor NAC Family

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.5	EF-hand_7	2	61	5.20E-10
PF00036.31	EF-hand_1	74	100	5.20E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02183	CALM	Ras signaling pathway	map04014
		Rap1 signaling pathway	map04015
		MAPK signaling pathway - plant	map04016
		Apelin signaling pathway	map04371
		Calcium signaling pathway	map04020
		Phosphatidylinositol signaling system	map04070
		cAMP signaling pathway	map04024
		cGMP-PKG signaling pathway	map04022
		Oocyte meiosis	map04114
		Cellular senescence	map04218
		C-type lectin receptor signaling pathway	map04625
		Insulin signaling pathway	map04910
		Glucagon signaling pathway	map04922
		GnRH signaling pathway	map04912
		Estrogen signaling pathway	map04915
		Oxytocin signaling pathway	map04921
		Melanogenesis	map04916
		Renin secretion	map04924
		Aldosterone synthesis and secretion	map04925
		Adrenergic signaling in cardiomyocytes	map04261
		Vascular smooth muscle contraction	map04270
		Salivary secretion	map04970
		Gastric acid secretion	map04971
		Dopaminergic synapse	map04728
		Long-term potentiation	map04720
		Neurotrophin signaling pathway	map04722
		Phototransduction	map04744
		Phototransduction - fly	map04745
		Olfactory transduction	map04740
		Inflammatory mediator regulation of TRP channels	map04750
		Circadian entrainment	map04713
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	Molecular Function	calcium ion binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	8.950
SRP064423	SRR2545915	Juvenile tuber	11.640
SRP108465	SRR5643513	five period of Gastrodia elata	149.790
	SRR5643514	five period of Gastrodia elata	67.120
	SRR5643515	five period of Gastrodia elata	96.770
	SRR5643524	five period of Gastrodia elata	61.020
	SRR5643525	five period of Gastrodia elata	63.990
	SRR5643528	five period of Gastrodia elata	1046.630
	SRR5643658	five period of Gastrodia elata	156.690
	SRR5643659	five period of Gastrodia elata	49.360
	SRR5643660	five period of Gastrodia elata	71.980
	SRR5643661	five period of Gastrodia elata	72.920
	SRR5643662	five period of Gastrodia elata	43.020
	SRR5643663	five period of Gastrodia elata	30.390
	SRR5643664	five period of Gastrodia elata	68.780
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	40.300
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	30.010
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	56.060
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	33.090
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	58.640
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	47.420
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	57.410
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	72.870
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	110.500
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	75.540
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	77.690
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	77.690
SRP279888	Gastro	Gastrodia elata tuber	53.30
	Juven	Juvenile tuber	5.70
	Mother_Gastro	Mother tuber of Gastrodia elata	393.92
	Mother_Juven	Mother tuber of Juvenile	33.20