Gene detail

Detail information of GWHGAAEX004906/evm.TU.scaffold_156.32

Functional Annotation

Database	Orthologs	E value	Annotation
KOG	KOG0167	1.00E-37	FOG: Armadillo/beta-catenin-like repeats
nr	gi\|743818832\|ref\|XP_010931344.1\|	4.59E-50	PREDICTED: U-box domain-containing protein 16-like [Elaeis guineensis]
Swissprot	tr\|Q9LZW3\|PUB16_ARATH	4.00E-38	U-box domain-containing protein 16
trEMBL	tr\|W9QXE8\|W9QXE8_9ROSA	8.00E-39	U-box domain-containing protein 16 {ECO:0000313\|EMBL:EXB42364.1}
TAIR	AT5G01830	1.00E-37	ARM repeat superfamily protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000160	1043870	1050306	+

Transcript Sequence
>GWHTAAEX004906 ATGTTGGAGAATGATGATGATTTGCTCAATCCAAACTCTTCTCTGTCTTCATCGACGAGCTTCTCTTCTGCAAGCAGCAAACCCCGAAACTCCCCCGCTCGGCATCCATCTTCTTTCGAGAAGAACCTCGCCGTCCTAAGCCAATTCAAAGCCCTACTCGTAGAATGCTCATCTCGCAACCACAACCGCTTTATTCTCTACTCCGATACTTTAGCCAACAACTTGTACGAGCTCATCCTTGGCCTCTCCACCCACCTCGACATTCTCCCCCTTCATTCTCCCTGTGTCTCCGACAATGGTTGCGATGTAGTTCGTCTCCTTCGCCTTCAGTGCCGTCGACCAGCCTCCACTGTCGATCCCAAAATATCCTTCCTCCGACACGAGATCTTCACCGTCATCAGCGACATCGGGCACGAAATCGTTGCCGATCACTGCCGCCTCTCCTCGTTCTTTCATCGCCTCGGCTTTAGTGACAGTCACAACTGCCAGCTCGAGATCCAACGCACGGAGCAGGAAATTGTGGTGGAATCATCCTCCTCTGAGAAATGGATGTCCGCGATGATCTCCCTTATAGGAATCGTGCGCTGCGCCAAGCATCTTCCACAGGGTCTCCACATCGAGATCCGATCCCCTTCTTGGCAAGCTCAACATTGCCTTCTTCGATTCCAACGGCATCCCTCCTTATTTCGTTGCTCTATCTCCCTCGACGTGACACTGGATTCCGTCATCGTGGCATGTGGGCATACGTTTGATCGGGACCATCACAGCACGTGTCCCATCACAAACCAAACCCTCAAGCACACAAACCTGATCCATCCAAAACAAAAGCAAGAGCAGTCATACAGACCTAAAATAATCCCTACATATAACTCTAAATCGGGTTAA

Network for GWHGAAEX004906

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module12	AUX/IAA_EAR_family AUX/IAA_EAR_family CYTOCHROME_P582_Family CYTOCHROME_P582_Family GO:0004725 protein tyrosine phosphatase activity GOslim:molecular_function GO:0008171 O-methyltransferase activity GOslim:molecular_function GO:0009733 response to auxin GOslim:biological_process GO:0010215 cellulose microfibril organization GOslim:biological_process GO:0015079 potassium ion transmembrane transporter activity GOslim:molecular_function GO:0031225 anchored component of membrane GOslim:cellular_component GO:0071805 potassium ion transmembrane transport GOslim:biological_process map02020 Two-component system map04075 Plant hormone signal transduction map04975 Fat digestion and absorption Protein Kinases RLK-Pelle_WAK Family Protein Kinases RLK-Pelle_WAK Family Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family Transcription factor C2H2 Family Transcription factor C2H2 Family Transcription factor SBP Family Transcription factor SBP Family

Module ID

Function Annotation

Module12

AUX/IAA_EAR_family AUX/IAA_EAR_family
CYTOCHROME_P582_Family CYTOCHROME_P582_Family
GO:0004725 protein tyrosine phosphatase activity GOslim:molecular_function
GO:0008171 O-methyltransferase activity GOslim:molecular_function
GO:0009733 response to auxin GOslim:biological_process
GO:0010215 cellulose microfibril organization GOslim:biological_process
GO:0015079 potassium ion transmembrane transporter activity GOslim:molecular_function
GO:0031225 anchored component of membrane GOslim:cellular_component
GO:0071805 potassium ion transmembrane transport GOslim:biological_process
map02020 Two-component system
map04075 Plant hormone signal transduction
map04975 Fat digestion and absorption
Protein Kinases RLK-Pelle_WAK Family Protein Kinases RLK-Pelle_WAK Family
Transcription factor AUX/IAA Family Transcription factor AUX/IAA Family
Transcription factor C2H2 Family Transcription factor C2H2 Family
Transcription factor SBP Family Transcription factor SBP Family

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016567	Biological Process	protein ubiquitination
GO:0004842	Molecular Function	ubiquitin-protein transferase activity

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.590
SRP064423	SRR2545915	Juvenile tuber	0.670
SRP108465	SRR5643513	five period of Gastrodia elata	1.160
	SRR5643514	five period of Gastrodia elata	0.950
	SRR5643515	five period of Gastrodia elata	1.080
	SRR5643524	five period of Gastrodia elata	0.870
	SRR5643525	five period of Gastrodia elata	1.160
	SRR5643528	five period of Gastrodia elata	2.030
	SRR5643658	five period of Gastrodia elata	2.340
	SRR5643659	five period of Gastrodia elata	1.200
	SRR5643660	five period of Gastrodia elata	1.320
	SRR5643661	five period of Gastrodia elata	1.240
	SRR5643662	five period of Gastrodia elata	0.950
	SRR5643663	five period of Gastrodia elata	0.580
	SRR5643664	five period of Gastrodia elata	1.660
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.670
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	1.320
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	1.750
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	1.010
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	1.840
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.760
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.970
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1.290
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	1.850
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	1.460
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	1.380
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	1.380
SRP279888	Gastro	Gastrodia elata tuber	1.14
	Juven	Juvenile tuber	1.51
	Mother_Gastro	Mother tuber of Gastrodia elata	4.43
	Mother_Juven	Mother tuber of Juvenile	3.90